Hasil Pencarian  ::  Simpan CSV :: Kembali

Hasil Pencarian

Ditemukan 148 dokumen yang sesuai dengan query
cover
Herry Wibisono
"Kelebihan berat badan dan Obesitas adalah suatu masalah kesehatan yang sedang bertumbuh pesat, terutama pada negara-negara berkembang. Indeks Massa Tubuh (IMT) adalah suatu indeks sederhana dari berat badan per tinggi badan yang sering digunakan untuk mengklasifikasi kelebihan berat badan dan obesitas pada orang dewasa. Mahasiswa kedokteran, terutama mahasiswa kedokteran dari Fakultas Kedokteran Universitas Indonesia (FMUI) rentan mendapatkan masalah kelebihan berat badan.
Studi ini adalah sebuah cross-sectional study yang membandingkan fungsi faal paru (FVC, FEV1, dan FEV1/FVC) antara individu-individu yang berberat badan normal atau kurang dengan individu-individu yang kelebihan berat badan ataupun obese. Didapatkan jumlah sampel sebesar 40 subjek yang terdiri dari 22 orang laki-laki dan 18 orang perempuan yang menunjukkan nilai FVC dan FEV1 yang lebih tinggi pada orang yang mengalami kelebihan berat badan ataupun obesitas pada laki-laki dan perempuan dibandingkan dengan mereka yang diklasifikasikan sebagai berberat badan normal atau kurang. Namun, persentase FEV1/FVC lebih rendah pada grup laki-laki dan perempuan yang kelebihan berat badan atau obese dibandingkan dengan laki-laki dan perempuan yang berberat badan normal atau kurang.
Perbedaan-perbedaan yang telah dijabarkan di atas tersebut bagaimanapun juga tidak signifikan secara statistic, kecuali pada skor FVC di grup laki-laki antara individu berberat badan normal atau kurang dengan individu-individu yang kelebihan berat badan ataupun obese (p=0.031). Riset lanjutan yang lebih mendalam dalam lingkup efek dari IMT terhadap fungsi faal paru masih sangat dibutuhkan dan riset ini dapat menjadi sebuah studi pendahuluan untuk riset yang lebih baik di masa yang akan datang.

Overweight and obesity is currently a growing health problem, especially in developing countries. Body Mass Index (BMI) is a simple index of weight-for-height that is commonly used to classify overweight and obesity in adults. Medical students, especially student of Faculty of Medicine University of Indonesia (FMUI), are prone to get overweight problems.
This study was a cross-sectional study which compares lung function (FVC, FEV1, and FEV1/FVC) between normal and underweight people with overweight or obese people. Total of 40 subjects which comprised of 22 males and 18 females were obtained, which shows higher FVC and FEV1 score for overweight or obese males and females compared to their counterparts. The FEV1/FVC percentage on the other hand, was lower in overweight or obese group than in normal or underweight group.
The differences however, was not statistically significant, except for FVC score in males group (p=0.031). Further research on the field of BMI effect on lung function is still largely needed and this research might act as a preliminary study for the greater good.
"
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2012
S-Pdf
UI - Skripsi Membership  Universitas Indonesia Library
cover
Marsandi Nugraprawira Mardjoeki
"Demam berdarah merupakan sebuah masalah kesehatan besar yang mengancam banyak negara tropis, termasuk Indonesia. Beberapa tahun terakhir penyakit ini berkembang menjadi semakin parah. Hal ini diperparah dengan tidak adanya antivirus maupun Vaksin untuk infeksi dengue. Penelitian ini bertujuan untuk melakukan desain primer untuk amplifikasi gen Non Structural -3 (NS-3) serotype 2 (DENV-2) strain Indonesia (AB189124) yang bisa disisipkan pada plasmid pPICZ-alphaA dan diekspresikan pada vektor Pichia pastoris. Hasil penelitian didapatkan pasangan primer yang dapat digunakan untuk membuat protein rekombinan NS-3 DENV-2. Pasangan primer tersebut adalah pasangan CGC + KpnI + Primer (4468) = CGC + GGTACC + TCCCGTGTCAATACCAATCA dan SacII + Primer (6495) = CCGCGG + AGCATGATTGTACGCCCTTC. Dengan mempertimbangkan sekuens keseluruhan gen NS-3 DENV-2, epitope, dan enzim restriksi pada plasmid dan NS-3, maka pasangan primer tersebut dapat digunakan untuk membuat protein rekombinan NS-3 DENV-2 sebagai kandidat Vaksin dengue.

Dengue Fever is a major health problem which threatens a lot of tropical countries, including Indonesia. In the last few years, this epidemic grew worse. This was aggravated by the nonexistence of neither vaccine nor antivirus capable of neutralizing dengue virus serotype 1-4. This research focused on designing primer for amplification of Non Structural-3 (NS-3) dengue virus serotype 2 (DENV-2) Indonesian strain (AB189124) which could be spliced into pPICZ-alhpaA and expressed on Pichia pastoris vector. Research result was a primer pair which could be used to produce NS-3 DENV-2 recombinant protein. These primer pair were CGC + KpnI + Primer (4468) = CGC + GGTACC + TCCCGTGTCAATACCAATCA dan SacII + Primer (6495) = CCGCGG + AGCATGATTGTACGCCCTTC. By considering overall sequence of NS-3 DENV-2 genes, epitope, and restriction enzyme on plasmid and NS-3, these primer pair could be use to produce NS-3 DENV-2 recombinant protein as a dengue vaccine candidate."
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2012
S-Pdf
UI - Skripsi Membership  Universitas Indonesia Library
cover
Nadia Tita Indriasti
"Demam berdarah dengue (DBD) telah menjadi masalah kesehatan. Indonesia merupakan salah satu negara dengan jumlah penderita DBD tertinggi di dunia. Riset ini bertujuan mengidentifikasi genotipe virus dengue serotype 4 yang beredar di Indonesia, khususnya Jakarta, pada tahun 2010. Selain itu, penelitian ini juga bertujuan untuk mengetahui serotipe dengue yang beredar di Jakarta. Riset dengen metode cross-sectional ini melibatkan 100 sampel yang selanjutnya dibagi berdasarkan hasil konfirmasi RT-PCR, seks, usia dan daerah domisili. Prevalensi tertinggi ditemukan pada usia umur 14-20 tahun dan pasien yang bertempat tinggal di Jakarta Timur. Sedangkan, ratio penderita antara wanita dan pria tidak menunjukkan perbedaan yang signifikan. Selain itu, dengan menggunakan software Genetyx, dapat diketahui bahwa genotipe yang bersirkulasi di Jakarta adalah tipe II. Selanjutnya, pembuatan primer dilakukan dengan program Primer Designer yang bertujuan untuk memperbanyak dan men-sequence whole genome dari DENV 4. Pada saat ini, data mengenai epidemiologi molekular terhadap infeksi dengue masih terbatas. Oleh karena itu, studi seperti ini penting untuk ditingkatkan agar tersedia informasi yang lebih lengkap mengenai genotipe yang beredar di Jakarta. Sebagai tambahan, penelitian semacam ini juga perlu dilakukan di daerah lain di Indonesia karena adanya variase genetik oleh virus dengue itu sendiri.

Over the past few decades, Dengue Hemorrhagic Fever (DHF) has become a global health problem. Indonesia is the one of the countries with highest cases in the world. This research is aimed to identify the genotype of serotype 4 in Indonesia, particularly in Jakarta, in the year 2010. The other objectives are to recognize the characteristic of dengue patients and to design primer for dengue serotype 4. This cross-sectional study involved 100 respondents who were later on categorized based on RT-PCR confirmation result, gender, age and domicile. The highest prevalence was found among patients of 14-20 years old and those who lived in East Jakarta. The predominant serotype circulating in Jakarta was DENV 2. Furthermore, by using Genetyx software, the genotype of serotype 4 circulated in Jakarta in 2010-2011 was type II. Next, whole genome of DENV 4 amplification and sequencing was carried out by using Primer Designer program. At present, the data about molecular epidemiology of dengue infection in Jakarta is still limited. Therefore, it is important to conduct other studies in this field in order to provide more complete information about genotype circulating in Jakarta. Furthermore, similar studies should be carried out in other areas in Indonesia to discover the other genotypes as the viral genetic may vary in different places."
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2012
S-Pdf
UI - Skripsi Membership  Universitas Indonesia Library
cover
Cita Christine Mayorita
"Saat ini, demam berdarah sudah menjadi masalah kesehatan di seluruh dunia. Penyakit ini makin sering terjadi bahkan seringkali menyebabkan kematian khususnya di beberapa negara Asia termasuk Indonesia. Tujuan dari penelitian adalah untuk mengetahui genotipe virus dengue serotype 1 di Indonesia sebagai dasar untuk turut ambil bagian dalam pengembangan diagnostik dan vaksin dari virus dengue.
Riset ini terdiri dari 100 responden yang terdiri dari pria dan wanita berusia antara 14-60 tahun. Semua sampel dipilih secara konsekutif dan virus dengue yang digunakan dalam riset ini dipilih secara acak pada bulan Maret 2010- Desember 2010. Kemudian dilanjutkan dengan proses sequencing pada bulan Januari 2011 sampai bulan Oktober 2011 yang bertempat di Departemen Mikrobiologi dengan metode cross sectional.
Hasil dari penelitian ini adalah virus dengue serotype 1 yang berasal dari strain Indonesia termasuk dalam golongan genotype 4. Saran yang dapat diberikan untuk riset selanjutnya adalah datanya harus lebih dilengkapi terlebih untuk data yang berasal dari berbagai provinsi di Indonesia.

Currently, dengue fever has become a worldwide health problem. This disease occurs more and more frequently and often cause death, especially in some Asian countries including Indonesia. The purpose of this study was to determine the genotype of dengue virus serotype 1 in Indonesia as a base to take part in the development of diagnostics and vaccines of the dengue virus.
This research consisted of 100 respondents consisting of men and women aged between 14 to 60 years. All samples were selected by consecutive and dengue viruses used in this study were randomly selected in March 2010 to December 2010. Afterwards, the next step was sequencing process in January 2011 to October 2011 in the Department of Microbiology by using cross sectional method.
The result of this study was dengue virus serotype 1 strains originating from Indonesia belonged to genotype 4. The suggestion for further research is the quantity of data should be increased especially for data collected from various provinces in Indonesia.
"
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2012
S-Pdf
UI - Skripsi Membership  Universitas Indonesia Library
cover
Mita Hapsari
"Demam berdarah dianggap sebagai masalah kesehatan utama bukan hanya di Indonesia, tetapi juga banyak negara lain. Penelitian ini bertujuan untuk mengetahui kinetik Non Structural-1 (NS1) dan persen positif antigen NS1 yang dideteksi dengan menggunakan diagnostik dini Strip Ag Bio-rad NS1 pada hari demam ke 1 sampai 3. Uji diagnostik ini dilakukan di Laboratorium Mikrobiologi Universitas Indonesia melalui pemeriksaan laboratorium pada 102 sampel dari pasien yang diduga demam berdarah. Standar baku untuk uji ini adalah Reverse Transcription - Polymerase Chain Reaction (RT-PCR), isolasi virus di cell line C6/36, serta kenaikan titer antibodi. Program SPSS 17.0 digunakan untuk analisis data. Dari total pasien yang terlibat dalam penelitian ini, 68 (68.3%) pasien terinfeksi demam berdarah. Investigasi lebih lanjut dalam mendeteksi keberadaan antigen NS-1 berdasarkan hari demam dilakukan pada penelitian ini. Berdasarkan hasil yang diperoleh, keberadaan NS-1 pada pasien terinfeksi demam berdarah pada hari demam ke 1, 2 dan 3 adalah 100%, 96,36%, dan 94.55% berturut - turut. Kesimpulan penelitian ini adalah bahwa Strip Ag Bio-Rad NS1 dapat digunakan sebagai deteksi dini demam berdarah di Indonesia.

Dengue is considered as a major health problem in not only Indonesia, but many other countries. The aim of this study was to know the kinetic of Non-Structural-1 (NS1) and positive percentage of NS1 detected by a diagnostic kit Bio-Rad NS1 Ag Strip Test during first until third day of fever. This diagnostic test was conducted in Microbiology Laboratorium of Universitas Indonesia by performing laboratory examination to 102 serum samples of dengue suspected patients. Gold standard of this study was Reverse Transcription - Polymerase Chain Reaction (RT-PCR), virus isolation in C6/36 cell line, and increase of antibody titer. SPSS 17.0 program was used to analyze the data. Based on total patients involved, 68 (68.3%) patients were infected with dengue. Further investigation on detecting presence of NS-1 antigen according to days of fever was done in this study. From the result, presence of NS-1in dengue-infected patients during day 1, 2, and 3 of fever were 100%, 96.36%, and 94.55% respectively. Conclusion of this study was that Bio-Rad NS1 Ag Strip can be used as early detection of dengue fever in Indonesia."
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2013
S-Pdf
UI - Skripsi Membership  Universitas Indonesia Library
cover
Catharina Nenobais
"[Infeksi dengue (DENV) merupakan salah satu masalah global yang masih dialami
hingga saat ini. Diperkirakan 50 hingga 100 juta orang di dunia positif mengalami
infeksi dengue.Hingga saat ini, tatalaksana infeksi dengue hanyalah berupa terapi
suportif dan belum ditemukan pengobatan dan vaksin dengue. Swietenia
Mahagoni sudah dikenal dan digunakan sejak dahulu sebagai tanaman obat.
Kandungan flavonoid pada tanaman ini diperkirakan memiliki efek antiviral.
Untuk itu penelitian ini dilakukan untuk melihat potensi antiviral terhadap DENV
dari ekstrak S. Mahagoni. Pada penelitian ini digunakan beberapa konsentrasi
yakni 640 μg/mL, 320 μg/mL, 160 μg/mL, 80 μg/mL, 40 μg/mL, 20 μg/mL, 10
μg/mL dan kontrol negatif adalah DMSO. Untuk menentukan hambatan
infektivitas dapat digunakan metode Focus Assay sehingga dapat diperoleh nilai
Inhibitory Concentration (IC50). Selain itu, untuk dilihat viabilitas sel dengan
metode MTT assay sehingga diperoleh nilai Cytotoxic Concentration (CC50).
Selain itu ditentukan juga nilai indeks selektivitas yang diperoleh dari
perbandingan CC50 dan IC50. Berdasarkan hasil IC50, CC50 dan SI yakni 68,97
μg/mL, 434,46 μg/mL dan 6,29, dapat dikatakan bahwa S. Mahagoni memiliki
efek antiviral sehingga dapat digunakan sebagai antiviral dengue dimasa
mendatang.;Dengue infection (DENV) still becomes as global burden. It is estimated 50 to
100 million people are positively infected by DENV. The recent management of
this disease has not been found yet, with the lack finding of medicine and vaccine,
the main management takes on supportive care. Swietenia mahagoni has been
used as the herbal medicine since long time ago. The flavonoid extract on that
plant is believed to have antiviral effect. This experiment was conducted to
evaluate the antiviral DENV potential of S. mahagoni extract. In this experiment,
the concentration was made on various concentration, from 640 μg/ml, 320
μg/mL, 160 μg/mL, 80 μg/mL, 40 μg/mL, 20 μg/mL, 10 μg/mL, and DMSO as
negative control. Focus assay was used to determine the infectivity inhibition
which results of IC50 (inhibitory concentration), and MTT Assay was used to
determine the cell viability which results of CC50 (cytotoxic concentration).
Selectivity index was also resulted by divided the value of CC50 with IC50. The
results of IC50, CC50, and SI of S. mahagoni was 68,97 μg/mL, 433,46 μg/ml, and
6,29 μg/ml respectively, S. Mahagoni has antiviral effect and could be consider to
be used as antiviral to DENV in the future, Dengue infection (DENV) still becomes as global burden. It is estimated 50 to
100 million people are positively infected by DENV. The recent management of
this disease has not been found yet, with the lack finding of medicine and vaccine,
the main management takes on supportive care. Swietenia mahagoni has been
used as the herbal medicine since long time ago. The flavonoid extract on that
plant is believed to have antiviral effect. This experiment was conducted to
evaluate the antiviral DENV potential of S. mahagoni extract. In this experiment,
the concentration was made on various concentration, from 640 μg/ml, 320
μg/mL, 160 μg/mL, 80 μg/mL, 40 μg/mL, 20 μg/mL, 10 μg/mL, and DMSO as
negative control. Focus assay was used to determine the infectivity inhibition
which results of IC50 (inhibitory concentration), and MTT Assay was used to
determine the cell viability which results of CC50 (cytotoxic concentration).
Selectivity index was also resulted by divided the value of CC50 with IC50. The
results of IC50, CC50, and SI of S. mahagoni was 68,97 μg/mL, 433,46 μg/ml, and
6,29 μg/ml respectively, S. Mahagoni has antiviral effect and could be consider to
be used as antiviral to DENV in the future]"
[, Fakultas Kedokteran Universitas Indonesia], 2015
S-Pdf
UI - Skripsi Membership  Universitas Indonesia Library
cover
Yasmina Zahra Syadza
"Indonesia merupakan salah satu negara dengan penyebaran kasus demam berdarah dengue (DBD) yang tinggi, dengan angka insiden 71.668 orang pada bulan Desember 2014. Hingga saat ini belum ditemukan antivirus untuk demam dengue (DD) dan DBD sehingga penatalaksanaan masih bersifat suportif. Kigelia africana (K. africana) yang memiliki sejumlah kandungan bermanfaat seperti flavonoid, yang digunakan sebagai bahan obat herbal untuk beberapa penyakit infeksi. Oleh sebab itu, pada penelitian ini, dilakukan uji untuk mengetahui potensi antiviral dari ekstrak dari daun K. africana terhadap virus dengue serotipe 2 (DENV-2) strain New Guinea C (NGC).
Penelitian dilakukan dengan mencari nilai CC50, IC50, dan indeks selektivitas (IS) dengan menggunakan methyl tetrazolium (MTT) assay dan focus assay. Didapatkan ekstrak daun K. africana memiliki pengaruh antiviral terhadap replikasi DENV, dengan CC50 = 439,12 μg/ml, IC50 = 37,36 μg/ml, dan IS = 11,75. Hasil tersebut menunjukan K. africana memiliki potensi sebagai antiviral untuk infeksi DENV. Namun, perlu dilakukan penelitian lebih lanjut untuk mengetahui kandungan ekstrak yang dapat menginhibisi replikasi DENV-2.

With 71.668 patients diagnosed on the mid-December 2014, makes Indonesia as a country with the highest disease of dengue haemorrhagic fever (DHF). It is known that dengue antiviral has not been established for dengue infection management, and only supportive care is widely used to manage the patient with the disease. Kigelia africana (K. africana) is mainly used in Africa region to cure infection disease, since it is known for having lots of potential substances like flavonoid. Therefore, it takes the probability that K. africana has the antiviral potency against dengue virus serotype 2 (DENV-2) strain New Guinea C (NGC).
The study was conducted by methyl tetrazolium (MTT) assay and focus assay for measuring the value of CC50, IC50, and selectivity index. The result of this study showed K. africana has an antiviral potency against DENV-2 with CC50 = 439.12 μg/ml, IC50 = 37.36 μg/ml, and selectivity index = 11.75. However, further research is needed to determine the exact content of leaf extract which has ability to inhibit the DENV-2 replication, to determine inhibition stage on DENV-2 replication cycle.
"
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2015
S-Pdf
UI - Skripsi Membership  Universitas Indonesia Library
cover
Cindy Gisella Zahrany
"Tingginya insiden infeksi demam berdarah yang terjadi dan tidak adanya vaksin efektif menyebabkan banyak peneliti mencoba ekstrak tumbuhan sebagai pengobatan alternatif pada virus Dengue (DENV). Curcumin merupakan salah satu ekstrak tumbuhan yang telah dibuktikan memiliki efek antiviral. Penelitian ini bertujuan untuk mengetahui apakah curcumin memiliki efek antiviral pada virus dengue. Oleh karena itu dilakukan tes untuk mengetahui persen hambatan curcumin pada replikasi DENV dan efek cytotoxic curcumin pada sel mamalia. Penelitian ini merupakan penelitian eksperimental yang dilakukan di Departemen Mikrobiologi FKUI. Pada penelitian ini terdapat enam kelompok yaitu perlakuan oleh curcumin dengan empat konsentrasi yang berbeda kontrol negatif dan juga Dimethil Sulfoxide (DMSO). Data yang didapatkan dari eksperimen ini akan dianalisis dengan metode T-test. Dari hasil penelitian terlihat bahwa curcumin terbukti dapat menghambat replikasi virus dengue. Pemberian dosis yang lebih tinggi dapat menghambat 100% replikasi virus. Pada saat konsentrasi curcumin diturunkan, maka penghambatan replikasi DENV secara dratis menurun. Dari data tersebut IC50 dari curcumin diperoleh yaitu kurang dari 0.1 µg/ml. Hasil data menunjukkan bahwa efek cytotoxic curcumin pada sel sangat signifikan pada kosentrasi yang tinggi. Pada konsentrasi yang lebih rendah, viabilitas sel terhitung lebih tinggi. Dari data tersebut dapat dihitung nilai CC50 yaitu 3,46 µg/ml. Dengan membandingkan nilai CC50 dan IC50 dari curcumin, didapatkan nilai selectivity index yaitu lebih dari 34. Dari penelitian ini dapat disimpulkan bahwa curcumin dapat digunakan sebagai antiviral virus dengue di masa mendatang.

The high incidence of dengue virus infection and also the absence of effective vaccine cause researchers to look up to use the natural extract as the alternative remedy against the dengue virus (DENV). Curcumin is one of the natural extracts that has already proven to have antiviral effect. The objective of this study experiment aimed to see whether curcumin can be used as the antiviral against dengue virus. Several experiments were conducted to obtain the percentage of inhibition of DENV replication and also to determine the cytotoxic effect of curcumin to mammalian cells. This study was an experimental study that had been conducted at Microbiology Departement of Faculty Medicine of Universitas Indonesia. In this experiment, there were six treatment groups such as four different concentrations of curcumin, negative control and Dimethyl sulfoxide (DMSO). The data from this study were analyzed using T-test method. From this study, the curcumin had been proven to successfully inhibit the replication of dengue virus. The treatment with higher dose of curcumin could totally inhibit the replication of DENV. When we gave less dose of curcumin, the percentage inhibition dropped significantly. This showed that inhibition by curcumin was in dose-dependent manner. Furthermore, from these data we determined the IC50 of curcumin which was less than 0.1 µg/ml. The CC50 of curcumin was 3,46µg/ml. By comparing the result of CC50 and IC50, we found the selectivity index value was more than 34. From this study, it can be concluded that Curcumin can be used as antiviral against dengue virus in the future."
2016
S-Pdf
UI - Skripsi Membership  Universitas Indonesia Library
cover
Puti Rineska Meilinda
"Infeksi virus dengue (DENV) masih merupakan masalah di seluruh wilayah Indonesia. Diperkirakan sebanyak 2,5 juta jiwa rentan terinfeksi DENV. Telah diupayakan kontrol transmisi DENV namun tidak dapat menekan transmisi penyakit. Terapi definitif dengue belum ada, padahal kadar virus dalam tubuh berhubungan dengan keluaran keparahan penyakit. Oleh sebab itu, penanganan infeksi DENV dititikberatkan pada antiviral dan vaksin.
Achyranthes aspera merupakan tanaman obat yang diketahui mengandung alkaloid, sterol, triterpene, flavonoid, dan kumarin. Tanaman ini menunjukkan aktivitas antibakteri, antifungsi, antioksidan dan antiviral terhadap Epstein Barr Virus.
Penelitian ini akan memperlihatkan efek ekstrak daun Achyranthes aspera terhadap replikasi DENV in vitro dengan mencari IC50,CC50, dan Selectivity Index (SI). Sel Huh7it-1 diinfeksikan dengan DENV yang telah diberi ekstrak dengan berbagai konsentrasi: 10, 20, 40, 80, 160, 320 μg/ml. Nilai IC50 didapatkan menggunakan metode Focus Assay, sementara CC50 dengan uji MTT. Data kemudian dianalisis dengan uji Kruskall-Wallis.
Hasil analisis menunjukkan IC50 ekstrak sebesar 43,29 μg/ml dan CC50 sel tidak terinfeksi sebesar 239,69 μg/ml. Kemudian didapatkan Indeks Selektivitas sebesar 5,53. Hasil uji kemaknaan menunjukkan semua konsentrasi terdapat perbedaan kecuali konsentrasi 20 dan 10 μg/ml. Kesimpulannya, ekstrak daun Achyranthes aspera menunjukkan efek inhibisi terhadap replikasi DENV dan tidak bersifat toksik terhadap sel pada konsentrasi inhibisi, sehingga dapat dikembangkan sebagai antiviral dimasa mendatang.

Dengue virus (DENV) infection is still a major problem in almost all area of Indonesia. Approximately, 2.5 billion people are vulnerable to be infected. The efforts to control DENV transmission had been done but they are not enough. The amount of virus infecting the body has a positive correlation with the severity of the disease yet definitive therapy has not yet been found. Thus, treatments developed for dengue are mainly focusing on antivirals and vaccines.
Achyranthes aspera is a medicinal plant which contains alkaloid, sterol, triterpene, flavonoid, and coumarine. Previous studies show that the plant has antibacterial, antifungal, antioxidant activities as well as antiviral to Epstein Barr Virus.
This research was conducted to evaluate the antiviral potency of Achyranthes aspera through IC50, CC50, and Selectivity Index (SI). Huh7it-1 cells were infected with DENV which had been mixed with extracts in various concentration: 10,20,40,80,160,320 μg/ml. IC50 was determined by Focus Assay while MTT test was used to determine CC50. Data were analyzed using Kruskal-Wallis test.
The results showed the IC50 and CC50 of the extract were 43.29 μg/ml and 239.69 μg/ml respectively and Selectivity Index 5.53. There was a significant difference (p<0,05) in all concentrations except 20 and 10 μg/ml. The leaf extract of Achyranthes aspera showed inhibition against DENV replication and was not toxic for cells. Thus, it could be developed as antivirals in the future.
"
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2015
S-Pdf
UI - Skripsi Membership  Universitas Indonesia Library
cover
Yan Martha Putri
"ABSTRACT
Dengue Hemorrhagic Fever (DHF) incidence in Indonesia can be classified as high, as the number of cases at the year of 2013 reached 44 cases and continues to rise. Until now there has no available specific antiviral towards dengue virus (DENV) yet. The aim of this research is to assess effect of isoamyl gallate as gallic acid derivate towards DENV-2 NGC replication in in vitro assessment. Huh-7 cells were cultured in 48 well plate and infected with DENV-2 NGC and combined with various concentration of isoamyl gallate. The CC50 was measured by MTT assay and IC50 was measured by focus assay. The significance of the data taken from each concentration was compared using Kruskall-Wallis and Mann-Whitney test. The result of the experiment showed the value of CC50, IC50, and SI were >80μg/mL, 6.2μg/mL, and 72.8 respectively. Kruskall-Wallis test showed that there was significant difference between each treatment using different concentration. However, for Mann-Whitney test, insignificant difference towards the control was shown in the concentration of 2.5μg/mL. IC50 value support the statement that isoamyl gallate will cause inhibition of DENV-2 NGC replication. With high value of SI, it can be concluded that isoamyl gallate could become an anti-DENV.

ABSTRAK
Kejadian demam berdarah dengue (DBD) di Indonesia tergolong tinggi, ditunjukkan dengan tingginya jumlah kasus pada tahun 2013 mencapai 44 kasus dan terus meningkat. Masalah yang dihadapi terkait terus berlanjutnya kejadian DBD adalah belum ditemukannya antivirus spesifik terhadap DENV. Tujuan dari penelitian ini adalah untuk mengetahui pengaruh isoamil galat sebagai turunan asam gallat terhadap replikasi DENV-2 NGC secara in vitro. Sel Huh-7 dikultur dalam 48 well plate dan ditambahkan campuran DENV-2 NGC dan ekstrak isoamil galat. Nilai CC50 diukur dengan MTT assay sedangkan nilai IC50 diukur dengan uji fokus. Perbedaan yang signifikan antar data yang diambil dari masing-masing konsentrasi dibandingkan dengan uji Kruskall-Wallis dan Mann-Whitney. Hasil penelitian menunjukkan nilai CC50, IC50, dan SI adalah >80μg/mL, 6.2μg/mL, and 72.8 secara berurutan. Uji Kruskall-Wallis menunjukkan bahwa ada perbedaan yang signifikan (p value<0.05) antara masing-masing perlakuan dengan menggunakan konsentrasi yang berbeda. Namun, untuk uji Mann-Whitney, perbedaan yang tidak signifikan terhadap kontrol ditunjukkan pada konsentrasi 2,5μg/mL. Nilai IC50 yang rendah dan CC50 yang tinggi memnunjukkan bahwa Isoamil galat akan menyebabkan penghambatan replikasi DENV-2 NGC dan tidak toksik pada sel. Nilai SI didapati secara signifikan tinggi (SI>10) sehingga ada kemungkinan bahwa Isoamil galat bisa menjadi anti-DENV"
2018
S-Pdf
UI - Skripsi Membership  Universitas Indonesia Library
<<   1 2 3 4 5 6 7 8 9 10   >>