"
ABSTRAKTaxoplasma gondii adalah protozoa intraselular yang dapat menyebabkan toksoplasmosis. Jenis perneriksaan yang banyak dilakukan untuk diagnosis toksoplasmosis pada saat ini adalah pemeriksaan serologi (enzyme-linked immunosorbent assay/ELISA) untuk mendeteksi adanya zat anti IgG dan IgM terhadap T.gondii di dalam serum, namun pemeriksaan serologi ini tidak adekuat. Oleh karena itu diperlukan pemeriksaan laboratorium yang tepat untuk mendiagnosis toksoplasmosis akut, dan dalam hal ini PCR merupakan teknik yang terpilih.
Penelitian ini bertujuan untuk menentukan konsentrasi minimal DNA T.gondii yang masih dapat terdeteksi oleh PCR dengan menggunakan target gen Bl dan gels P30 T.gondii.
PCR terhadap target gen B1 dilakukan menurut metode Chang & Ho dan gen P30 menurut metode Weiss dkk. dan Chang & Ho. Primer gen BI terdiri dari oligo 1 : 5'GGAACTGCATCCGTTCATGAG3' dan oligo 2 : 5'TCTTTAAAGCGTTCGTG GTC3'. Primer gen P30 terdiri dari oligo 1 : 5'CACACGGTTGTATGTCGOT-I ICGCT3' dan oligo 2 : 5'TCAAGGAGCTCAATG TTACAG CCT3'.
Pada penelitian ini, PCR dengan target gen P30 yang dilakukan menurut metode Weiss dkk. memberikan pita yang tidak spesifik, karena itu dilakukan juga PCR dengan metode menurut Chang & Ho. Pada metode Chang & Ho penggunaan siklus sebanyak 30, 35, 40 dan 45 siklus tidak memberikan gambaran pita, sedangkan penggunaan 50 siklus baru memberikan hasil pita spesifik T.gandii pada elektroforesis. Hasil yang diperoleh menunjukkan bahwa konsentrasi minimal DNA T.gondii yang masih terdeteksi dengan menggunakan target gen B1 pada sampel DNA murai T.gondii adalah sebesar 0,1 pg, pada sampel DNA murni T.gondii yang dicampur dengan DNA manusia sehat sebesar 1 pg, sedangkan pada darah manusia sehat yang dicampur dengan suspensi takizoit masih dapat terdeteksi sampai jumlah DNA dalam 1 takizoit. Dengan target gen P30 hasil yang diperoleh menunjukkan bahwa konsentrasi minimal DNA T.gondii yang rnasih terdeteksi pada sampel DNA murni T.gondtl adalah 1 pg, pada sampel DNA murni T.gondii yang dicampur dengan DNA manusia sehat adalah 0,025 ng dart pada sarnpel darah manusia sehat yang dicampur dengan suspensi takizoit adalah DNA yang berasal dari minimal 20 takizoit.
Dengan demikian dapat disimpulkan bahwa uji yang menggunakan target gin B1 lebih sensitif dibandingkan dengan gen P30.
ABSTRACTDetermination of Minimal Concentration of The DNA Toxoplasma gondii Which Still Can be Detected by The Polymerase Chain Reaction Using BI and P30 Genes.Taxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. Serological test (ELISA) for detecting the presence of IgG and IgM antibodies against T.gondii is usually performed nowadays, however this serological test is not adequate. Therefore an accurate laboratory test is needed for diagnosing acute toxoplasmosis, and in this case the polymerase chain reaction (PCR) is the method of choice.The aim of this study is to assess the minimal concentration of the DNA of T.gondii which still can be detected by the PCR using B1 and P30 genes as targets.The PCR against B1 gene as target was performed by using the method described by Chang & Ho, and described by Weiss et al and Chang & Ho against P30 gene as target. The B1 gene primers consisted of oligo 1 :5'GGAACFGCATCCGTTCATGAG3' and oligo 2 : 5'Te ITAAAGCGTTCGIGC3TC3', whereas the P30 gene primers consisted of oligo 1 5'CACACGGTTGTATGT'CGG ITI'CGCT3' and oligo 2 : 5'TCAAGG AGCTCAAT GTTACAGCCT3'.It was shown that no specific bands were observed in the PCR with P30 gene as target (performed according to the method described by Weiss et al), therefore another PCR according to the method described by Chang & Ho was performed. In this method the electrophoresis did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed.The results obtained showed that the minimal DNA concentrations which still could be detected using B1 gene as target were as the following : 0.0001 ng DNA in 50 1~1 PCR solution from samples of pure DNA, 0.001 ng DNA 1 50 1.11 PCR solution from samples of pure DNA mixed with normal human blood and the amount of DNA originated from at least 1 tachyzoite . Likewise, the minimal DNA concentrations which could still be detected using P30 as target gene were : 0.001 ng DNA in 50 tit PCR solution from samples ofpure DNA, 0.025 ng DNA in 501.11 PCR solution from samples of pure DNA mixed with normal human blood and the amount of DNA originated from at least 20 tachyzoites.It was concluded that the assay using B1 gene as target was more sensitive than the one using P30 gene as target."
