Hasil Pencarian  ::  Simpan CSV :: Kembali

Abstrak :
Toxoplasma gondii adalah protozoa intraselular yang dapat menyebabkan toksoplasmosis. Pada orang sehat (imunokompeten) infeksi biasanya tidak disertai gejala klinis, sedangkan pada penderita imunokompromais terutama pada penderita AIDS infeksi dapat berakibat fatal. Infeksi primer pada wanita hamil dapat mengakibatkan terjadinya transmisi melalui plasenta ke janin. Karena itu pemeriksaan laboratorium mutlak diperlukan untuk menentukan adanya infeksi T.gondii, sehingga pengobatan dapat diberikan dengan segera untuk menghindari kerusakan lebih lanjut. Penelitian ini bertujuan untuk menentukan apakah Polymerase chain reaction (PCR) dengan menggunakan gen P30 dapat mendeteksi DNA T.gondii. Pada DNA yang diisolasi dilakukan PCR terhadap target gen P30 menurut metode menurut metode Weiss dkk. dan Chang & Ho. Primer gen P30 terdiri dari oligo 1 : 5'CACACGGTTGTATGTCGGTTTCGCT3' dan oligo 2 : 5'TCAAGGAGCTCAATG TTACAGCCT3'. Sampel DNA yang digunakan untuk PCR dengan target gen P30 terdiri dari berbagai macam bahan yaitu : (a) DNA murni T.gondii dengan berbagai konsentrasi, (b) campuran DNA murni T.gondii dengan DNA darah manusia sehat, (c) DNA dari takizoit yang berasal dari campuran 99 ml darah manusia sehat dengan 1 ml suspensi takizoit yang masing-masing mengandung 1000,100, 50, 40, 30, 20 dan 10 takizoit. PCR dengan target gen P30 yang dilakukan menurut metode Weiss dkk. memberikan pita yang tidak spesifik. Pada metode Chang & Ho penggunaan siklus sebanyak 30, 35, 40 dan 45 siklus tidak memberikan gambaran pita, sedangkan penggunaan 50 siklus baru memberikan hasil pita spesifik T.gondii pada elektroforesis. Hasil yang diperoleh menunjukkan bahwa konsentrasi minimal DNA T.gondii yang masih terdeteksi pada sampel DNA murni T.gondii adalah 1 pg, pada sampel DNA murni T.gondii yang dicampur dengan DNA manusia sehat adalah 0,025 ng dan pada sampel darah manusia sehat yang dicampur dengan suspensi takizoit adalah DNA yang berasal dari minimal 20 takizoit. Dengan demikian dapat disimpulkan PCR dengan menggunakan target gen P30 dapat digunakan untuk mendeteksi DNA T.gondii.

---

Detection of P30 gene to diagnosis of toxoplasmosis by using polymerase chain reaction. Toxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. In healthy persons (immunocompetent) the infection is usually asymptomatic; however in immunocompromised patients, especially AIDS patients, the infection can be fatal. Primary infection in pregnant women can be transmitted to the fetus via the placenta. Therefore laboratory examination is absolutely neccesary to assess the presence of T.gondii infection hence prompt treatment can be given to prevent further damage. The aim of this study is to know whether by using P30 gene as target the Polymerase chain reaction (PCR) can detect T.gondii DNA in Indonesia. The PCR was performed on the DNA which had been isolated against P30 gene as target by using the method described by Weiss et al and Chang & Ho. The P30 gene primers consisted of oligo 1: 5'CACACGGTTGTATGTCGGTTTCGCT3' and oligo 2: 5'TCAAGGAGCTCAATGTTAC GCT3'. The DNA samples used in the PCR with P30 gene as target were derived from the following materials: (a) pure T.gondii DNA of various concentrations, (b) a mixture of pure T.gondii DNA and normal human blood DNA, (c) tachyzoite DNA derived from the mixture of 99 ml normal human blood and 1 ml tachyzoite suspension with the following amount of tachyzoites :1000,100, 50, 40, 30, 20 and 10 tachyzoites. It was shown that no specific bands were observed in the PCR with P30 gene as target (performed according to the method described by Weiss et al). The PCR according to the method described by Chang & Ho did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed. The results obtained showed that the minimal DNA concentrations which still could be detected using P30 gene as target were as follows : 0.001 ng DNA in 50 ml PCR solution from samples of pure DNA, 0.025 ng DNA in 50 ml PCR solution from samples of pure DNA mixed with normal human blood and the amount of DNA originated from at least 20 tachyzoites. It was concluded that the assay using P30 gene as target could be used for detecting T.gondii DNA in Indonesia.

Abstrak :
Toxoplasma gondii adalah protozoa intraselular yang dapat menyebabkan toksoplasmosis. Jenis pemeriksaan yang banyak dilakkukan untuk diagnosis toksoplasmosis pada saat ini adalah pemeriksaan serologi (enzyme-linked immunosorbent assay / ELISA) untuk medeteksi anti IgG dan Ig M terhadao T.gondii di dalam di dalam serum, namun pemeriksan serologi ini tidak adekuat. Oleh karena itu diperlukan pemeriksaan laboratorium yang tepat untuk mendiagnosis toksoplamosis akut, dan dalam hal ini PCR merupakan teknik yang terpilih. Penelitian ini bertujuan untuk menentukan konsentrai minimal DNA T. gondii yang masih dapat terdeteksi oleh PCR dengan menggunakan targaet gen B1 dan gen P30 T. gondii. PCR terhdap target gen B1 dilakukan menurut metode Chang & Ho dan gen P30 menurut metode Weiss dkk dan aligo 2:5'TCTTTAAAAGCGTTCGTG GTC3' Primer gen P30 terdiri dari oligo 1 : 5'CACACGGTTGTATGTCGGTTTCGCT3' dan oligo 2 : 5'TCAAGGAGCTCAATG TTACAG CCT3'. Pada penelitian ini PCR dengan target gen P30 yang dilakukan menurut metode Weiss dkk memberikan pita yang spesifik dan tidak spesifik. Pada metode Chang & Ho penggunaan siklus sebanyak 30, 35, 40, 45 siklus tidak memberikan gambaran pita, sedangkan penggunaan 50 siklur baru memberikan hasil pita spesifik T.gondii pada elektroforesis. Dapat disimpulkan bahwa uji yang menggunakan target gen B1 lebih sensitif dibandingkan dengan gen P30.

---

Toxoplasmagondii is an intracellular protozoan which causes toxoplasmosis. A serological test (ELISA) for detecting the presence of IgG and IgM antibodies against T.gondii is usuall performed nowadays, however this serological test is not adequate. Therefore an accurate laboratory test is neede for diagnosing acute toxoplasmosis and in this case the polymerase chain reaction (PCR) is the method of choice. The aim of this study is to assess the minimal concentration of the DNA of T.gondii which still can be detected by the PCR using B1 and P30 gene as targets.

Abstrak :
ABSTRAK
Taxoplasma gondii adalah protozoa intraselular yang dapat menyebabkan toksoplasmosis. Jenis perneriksaan yang banyak dilakukan untuk diagnosis toksoplasmosis pada saat ini adalah pemeriksaan serologi (enzyme-linked immunosorbent assay/ELISA) untuk mendeteksi adanya zat anti IgG dan IgM terhadap T.gondii di dalam serum, namun pemeriksaan serologi ini tidak adekuat. Oleh karena itu diperlukan pemeriksaan laboratorium yang tepat untuk mendiagnosis toksoplasmosis akut, dan dalam hal ini PCR merupakan teknik yang terpilih.

Penelitian ini bertujuan untuk menentukan konsentrasi minimal DNA T.gondii yang masih dapat terdeteksi oleh PCR dengan menggunakan target gen Bl dan gels P30 T.gondii.

PCR terhadap target gen B1 dilakukan menurut metode Chang & Ho dan gen P30 menurut metode Weiss dkk. dan Chang & Ho. Primer gen BI terdiri dari oligo 1 : 5'GGAACTGCATCCGTTCATGAG3' dan oligo 2 : 5'TCTTTAAAGCGTTCGTG GTC3'. Primer gen P30 terdiri dari oligo 1 : 5'CACACGGTTGTATGTCGOT-I ICGCT3' dan oligo 2 : 5'TCAAGGAGCTCAATG TTACAG CCT3'.

Pada penelitian ini, PCR dengan target gen P30 yang dilakukan menurut metode Weiss dkk. memberikan pita yang tidak spesifik, karena itu dilakukan juga PCR dengan metode menurut Chang & Ho. Pada metode Chang & Ho penggunaan siklus sebanyak 30, 35, 40 dan 45 siklus tidak memberikan gambaran pita, sedangkan penggunaan 50 siklus baru memberikan hasil pita spesifik T.gandii pada elektroforesis. Hasil yang diperoleh menunjukkan bahwa konsentrasi minimal DNA T.gondii yang masih terdeteksi dengan menggunakan target gen B1 pada sampel DNA murai T.gondii adalah sebesar 0,1 pg, pada sampel DNA murni T.gondii yang dicampur dengan DNA manusia sehat sebesar 1 pg, sedangkan pada darah manusia sehat yang dicampur dengan suspensi takizoit masih dapat terdeteksi sampai jumlah DNA dalam 1 takizoit. Dengan target gen P30 hasil yang diperoleh menunjukkan bahwa konsentrasi minimal DNA T.gondii yang rnasih terdeteksi pada sampel DNA murni T.gondtl adalah 1 pg, pada sampel DNA murni T.gondii yang dicampur dengan DNA manusia sehat adalah 0,025 ng dart pada sarnpel darah manusia sehat yang dicampur dengan suspensi takizoit adalah DNA yang berasal dari minimal 20 takizoit.

Dengan demikian dapat disimpulkan bahwa uji yang menggunakan target gin B1 lebih sensitif dibandingkan dengan gen P30.

---

ABSTRACT
Determination of Minimal Concentration of The DNA Toxoplasma gondii Which Still Can be Detected by The Polymerase Chain Reaction Using BI and P30 Genes.

Taxoplasma gondii is an intracellular protozoan which causes toxoplasmosis. Serological test (ELISA) for detecting the presence of IgG and IgM antibodies against T.gondii is usually performed nowadays, however this serological test is not adequate. Therefore an accurate laboratory test is needed for diagnosing acute toxoplasmosis, and in this case the polymerase chain reaction (PCR) is the method of choice.

The aim of this study is to assess the minimal concentration of the DNA of T.gondii which still can be detected by the PCR using B1 and P30 genes as targets.

The PCR against B1 gene as target was performed by using the method described by Chang & Ho, and described by Weiss et al and Chang & Ho against P30 gene as target. The B1 gene primers consisted of oligo 1 :5'GGAACFGCATCCGTTCATGAG3' and oligo 2 : 5'Te ITAAAGCGTTCGIGC3TC3', whereas the P30 gene primers consisted of oligo 1 5'CACACGGTTGTATGT'CGG ITI'CGCT3' and oligo 2 : 5'TCAAGG AGCTCAAT GTTACAGCCT3'.

It was shown that no specific bands were observed in the PCR with P30 gene as target (performed according to the method described by Weiss et al), therefore another PCR according to the method described by Chang & Ho was performed. In this method the electrophoresis did not show any band when 30, 35, 40 and 45 cycles of PCR were used however, by using 50 cycles a specific band was observed.

The results obtained showed that the minimal DNA concentrations which still could be detected using B1 gene as target were as the following : 0.0001 ng DNA in 50 1~1 PCR solution from samples of pure DNA, 0.001 ng DNA 1 50 1.11 PCR solution from samples of pure DNA mixed with normal human blood and the amount of DNA originated from at least 1 tachyzoite . Likewise, the minimal DNA concentrations which could still be detected using P30 as target gene were : 0.001 ng DNA in 50 tit PCR solution from samples ofpure DNA, 0.025 ng DNA in 501.11 PCR solution from samples of pure DNA mixed with normal human blood and the amount of DNA originated from at least 20 tachyzoites.

It was concluded that the assay using B1 gene as target was more sensitive than the one using P30 gene as target.