Hasil Pencarian  ::  Simpan CSV :: Kembali

Abstrak :
ABSTRAK
Ruang Lingkup dan Cara Penelitin : Perubahan glikoprotein membrari sel sering dihubungkan dengan transformasi keganasan. Salah satu komponen karbohidrat glikopro tein membren adalah L?fukosa. . Diketahui bahwa kadar L? fukosa glikoprotein dalam serum penderita berbagai keganasan lebih tinçgi dibandinçkan dengan normal. Jika peningkatan kadar fukosa glikoprotein terjadi cukup dini, penentuannya mungkin dapat menuniukkan awal perubahan ke arah keganasan. Untuk nengetahui apakah peningkatan kadar luko?a serum terjadi pada awal peru? bahan ke arch keganasan hati, maka diteliti bagaimana hubungan perubahan kadar fukosa serum dan gambaran mikroskopis jaringan hati tikus yang diberi aflatoksin B1 (AFB1) untuk menginduksi kanker. Dalam penelitian ini digunakan 36 tikus diberikan AFB1. dari 36 tikus dlberikan pelarut Wb1. Aflatoksin dengan pelarut dimetilformamida diberikan secara inkubasi lambung 20 ug, sekali 2 hari selama 12 minggu. Pengambilan serum dari hati tikus dilakukan, setiap 4 minggu mulai minggu ke?8 sampai minggu ke?40. Penentuan kadar fukosa serum dilakuken sesuai dengan metode yang dilakukan oleh Winzler dan sediaan jaringan hati dibuat dengan pewar naan HE menurut Bhomer.

Hasil dan Kesjmpulan: Hasjl penelitian menunjukkan, bahwa kenaikan kadar fukosa glikoprotein serum tikus yang diberi AFB. lebih tinggi secara bermakna dibandingkan dengan kontrol. Kadar rata?rata fukosa serum tikus yang diberi AFB1 seluruh pengamatan adalah 13,09 ± 0,99 mgflOO mL dan tikus kontrel cdalah 11,72 ± 0,84 mg/lOO mL. Disamping itu ternyata ada kecenderungan peningka tan kadar lukosa serum sejalan dengan waktu, namun kenaikan peningkatan ini secara statistik belum bermak na untuk pengukuran pada waktu pengamatan yang sama. Jaringan hati tikus yang diberi AFB1, memperlihatkan gambaran, hiperplasia saluran empedu (perubahan awal ke arah keganasan) mulai pengamatan minggu ke?36. Dari hasil penelitian ini: dapat disimpulkan, bahwa pemberian AFBJ menyebabkan peningkatan kadar lukosa serum, namun pada penelitian ini belum depat dinyatakan perbedaan yang bermakna pada seat sel menunjukkan perubahan awal ke arah keganasan.

---

ABSTRACT
Scope and Method of Study: Cell membrane glycoprotein changes is often related to malignant transformation. One of the carbohydrate components of membrane glyco protein, often observed to be increased in malignan cies, is L?fucose. If this increase appears early during the formation of malignancies it could be used as a marker. The aim of this study was to determine whether an increase of serum fucose concentration can be detected during early malignant transformation. Thirty six rats were administrated aflatoxin B1 in dimethylformamide by gastric intubation and 36 rats were used as controls. Aflatoxin was given in 20 ug dosages every two days for a period of 12 weeks. Serum and liver samples were collected once every 4 weeks from week?8 until week?40. Serum fucose concentration measured by the method introduced by Winzler ana liver slices were stained with hematoxylin and .eosin according to Bhomer.

Findings and conclusions: The serum protein?bound fucose concentration in rats treated with aflatoxin B1, was significantly higher than in the control group. The mean concentration in the treated rats was 13.09 ± 0.99 mg/l00 mL and in the control group was 11.72 ± 0.84 mg/l00 mL. There was also a positive correlation between the increase of serum fucose concentration and the time of observation, although the increase in both groups measured concurrently did not show significant differences. The aflatoxin B1 treated rats show bile duct hyperplasja (known as one of the earliest apparent preneoplastic changes) as early as the 36th week. It can be concluded that the administration of aflatoxin 8 causes increased serum fucose levels, although in this study at the onset of cell differentiation toward malignancy, this difference was still not significant.

Abstrak :
Telah dilakukan isolasi senyawa kimia dan uji toksisitas akut (fetal dosis 50) serta uji antiinflamasi terhadap kulit batang tumbuhan Hunyur bunt (Kadsura scandens B1) yang merupakan salah satu tumbuhan di Indonesia. Isolasi senyawa dilakukan dengan cara maserasi dan perkolasi kulit batang tumbuhan Kadsura scandens dengan menggunakan pelarut n-heksana, kemudian dilanjutkan dengan pelarut metanol pada temperatur ruang. Uji toksisitas akut (letal dosis 50) dilakukan berdasarkan metode Weil C.S memakai mencit strain C.B.R. Swiss, sedangkan uji antiinflamasi dari infus tumbuhan Kadsura scandens Bl dilakukan menurut cara yang dilakukan oleh Winter dan kawan-kawan dengan melihat efek penghambatan udem yang ditimbulkan oleh karagenin pada telapak kaki tikus putih dari galur Wistar. Senyawa yang terisolasi dari ekstrak n-heksana diperoleh senyawa alkohol rantai panjang nonakosanol dan asam betulinat senyawa triterpen pentasiklik tipe lupan. Dari ekstrak metanol diperoleh senyawa glikosida sitosterol : 3-0-13-D-glukopiranosil sitosterol. Penetapan struktur dilakukan dengan cara spektroskopi. Uji toksisitas akut (fetal dosis 50) menunjukkan bahwa tumbuhan ini termasuk tumbuhan golongan bahan praktis tidak toksik (Practically Non Toxic Substance), sedangkan hasil uji antiinflamasi pada dosis 24 mg/100 g berat badan mempunyai efek yang setara dengan pembanding fenilbutason 10 mg/ 100 g berat badan pada jam kedua dan ketiga. Pada dosis 2,7 dan S mg /100 g berat badan mulai jam kedua sudah menunjukkan aktivitas sebagai antiinflamasi, tetapi tidak setara dengan pembanding fenilbutason 10 mg/ 100 g berat badan.

---

Isolation of chemical constituens of crude extract of Kadsura scandens stem bark had been conducted and a test on a 50 lethal dose toxic as well as on antiinflamation.The plant found out in Indonesia. Separation and isolation of the compounds were done by maceration and percolation system at room temperature using n-hexane followed by methanol solvent. The lethal toxic test dose was carried out, based on the Well C.S. methode using mice strain C.B.R Swiss, while the test on anti-inflammatory activity toward udem which was given rise by the induction of carrageenan rat paw oedema. The isolated compounds from the n-hexane extract are a long chain alcohol (nonacosanol) and betulinic acid, which belong to the pentacyclic triterpenoidiupane type. From the methanol extract was isolated a glycoside sitosterol , 3-O-13-D-glucopyranosil sitosterol. The structural elucidation was established by spectroscopic method. The test on 50 lethal toxic dose showed that this plant belongs to the practically non toxic substance, while the result of the anti-inflamation test on 24 mg/100 g dosage, had got an effect which was equal with the comparative phenylbutason 10 mg/IOO g physical weight after two and three hours. In Within 2,7 and 8 mg/ 100 g physical weight after two hours had shown the activities as anti-inflamation therapy but it was not balanced with the comparative phenylbutason 10 mg/ 100 g physical weight.

Abstrak :
Tujuan dan metade penelirian : Penelitian ini bermjuan untuk mengetahui efek pemberian kombinasi vitamin B1, B6, B12 untuk mengatasi kelelahan dan menurunkan akurnulasi asam laktat yang diinduksi oleh keija fisik. Keleiahan atau fatigue adaiah keadaan otot yang tidal( mampu Iagi berkontraksi akibat menurunnya pasokan darah dan ATP, peningkatan timbunan asam laktat di otot, serta ketidakmampuan neuromuscular junction untuk meneruskan rangsangan karena sebagian besar asetilkolin telah dilepaskan. Kelelahan dapat terjadi pada setiap tahapan proses kontraksi otot, mulai dari tahap scl otot sampai keielahan umum. Di Indonesia, kombinasi vitamin B1, B6, B12 dengan dosis tinggi dipromosikan sebagai makanan suplemen antikelelahan. Vitamin-vitamin tersebut sebenamya merupakan bahan nutrisi organis yang diperlukan hanya dalam jumlah kecil untuk berbagai proses biokimia dan umumnya tidak dapat disintesa oleh tubuh sehingga hams dipenuhi dan makanan. Karena sifatnya yang ianit dalam air, rnaka kelebihan di dalam tubuh langsung dieksresikan bersama urin. Jadi cadangan vitamin tersebut di dalam tubuh menjadi terbatas dan sebagai konsekuensinya harus dipasok dari makanan secara terus menerus. Dengan demikian terdapat ketidaksesuaian Bntam peranan vitamin Bl, B6, B12 dosis tinggi dengan penggunaannya sebagai antiicelelahan. Untuk membuktikan pengaruh pemberian kombinasi vitamin B|, B6, dan B12 dosis tinggi dalam mengurangi kelelahan, digunaican metode untuk menguji efektivitas vitamin Bl, BE, Bl; daiam mengtu-angi kelelahan ini. Metode penguji yang digunakan berupa uji renang (swim test) clan pengulcuran asam laktat plasma. Penelitian ini merupakan studi eksperimental in vivo, menggunakan tikus putih jantan galur Sprague- Dawley dengan berat badan 150-200 g. Disiapkan 30 ekor tikus putih, yang dibagi rnenjadi 2 kelompok sccara acak, yaitu kelompok yang mendapat kombinasi vitamin Bl, B6 ,B12 per soncle dengan tiap sondenya mengandung 3 mg Vitamin BL 6 mg vitamin B5 dan B6 vitamin B12 dan kelompok yang hanya mendapat l ml akuades sebagai kontrol. Rancangan penelitian ini menggunakan desain cross over. Setelah dilakukan percobaan uji renang pada tiKus yang telah diberi kombinasi vitamin B¢,B5,B11 personde, dilihat berdasarkan tingkat kelelahannya bempa kekuamn struggling dan dibandingkan dengan Likus yang hanya mendapat plasebo, demildan pula kadar asam laktatnya. Hasi! dan Kesimpulan : Dalam peneiitian ini didapatkan data lama struggling tikus yang rnendapat vitamin dibandingkan kontrol tidak berbeda bermakna (P=0,37l). Demikian pula kadar akumulasi asam laktat pada tikus yang mendapat vitamin, tidak berbeda bermakna (P=0,948) dibandingkan dengan kontrol. Sehingga dapat disimpulkan, dalam kondisi puasa kombinasi vitamin B,, B¢, Bu tidak mengurangi keielahan pada tikus yang diberi exercise. Demikian pula penurunan akumulasi asam laktatya.

---

Purpose and method of the research: The present study is aimed to find out whether the combination of vitamins B., B5, Bl; is effective to alleviate fatigue and accumulating physical work-induced lactate acid. Fatigue is a state that muscles are incapable of contraction process, fiom brain level to muscle cell, including such systems maintaining energy supply as cardiovascular and respiiation thuctions. In Indonesia, high dose of combined vitamin B|, B5, B12 has been promoted as food or beverage to decrease fatigue. Actually, those vitamins are organic nutrition material required only in small amount for various biochemi process and, in general, could not be synthesized by human body. Due to water soluble in character, their excess would be excreted directly with urine. Thus, stock of these vitamins become limited in the body and, as a result, food should supply them continually. The objective of this study is to prove the effects of administering high dose vitamin B|, B5 and Bu in combination to alleviate fatigue. Method used is swim test and plasma lactic acid measurement. This research is an in vivo experimental study by using Sprague-Dawley iimow white mice with body weight between 150-200 g. Thirty white mice were prepared and divided into two group in random, that is one group receiving combined vitamins Bl, B5, Bn (3 mg of vitamin B6 mg vitamin B5, and 6 pg vitamin B12 in each). Subsequently, they were compared to another one accepting only l ml of aqua as control- The research uses cross over design. After performing swim test to a group of mice taking vitamins Bl, Bé, B12 in combination, we observed tl1eir struggling capacity and compared to those receiving placebo. Therefore, this research utilized 2 parameters, that is struggling and lactic acid accumulating in blood. These two parameters indicated fatigue level of experimental mice with swim test. Results and Conciusionsr It is found that data of mice?s struggling time with vitamin were not significantly different with (P=0,371) the control one. In addition, accumulating lactic acid levels between mice with vitamins and the control were also not significantly different (P=0,948). We may conclude that; Vitamin Bb B5, Bu in combination have not decreased fatigue in mice with exercise in the fasting condition and no effects on accumulating lactic acid with exercise in the fasting conditions.

Abstrak :
[ABSTRAK
Antibodi poliklonal anti aflatoksin B1 telah berhasil diproduksi pada hewan uji kelinci betina New Zealand White setelah diimunisasikan hapten aflatoksin B1-CMO yang dikonjugasikan dengan Bovine Serum Albumin (BSA) sebagai antigen. Hapten aflatoksin B1-CMO disintesis menggunakan metode karbodiimida dengan substrat aflatoksin B1 dan carboxymethyl hydroxylamine hemihydrochloride (CMO) sebagai linkernya. Hasil karakterisasi kromatografi lapis tipis dengan nilai Rf rata-rata sebesar 0.395, spektrum UV-Visibel dengan puncak λ maks pada 362, 264, 218 nm, spektrum IR dengan puncak 3448.126 cm-1 (3000-3600 cm-1) : OH, pada 1632.249 cm-1(1540-1725 cm-1) : C=O, dan 1642.451 cm-1 (1640-1690 cm-1) :C=N (Oksim), dan hasil fragmentasi spektrometri massa (MS/MS) pada m/z 386, 368.2, 310 membuktikan hapten aflatoksin B1-CMO berhasil disintesis. Hapten ini kemudian dikonjugasikan dengan BSA membentuk antigen aflatoksin B1-BSA (AFB1-BSA) sebelum diimunisasikan ke kelinci. Spesifitas antigen AFB1-BSA terhadap antibodinya dan uji konjugasi hapten ke BSA menunjukkan hasil positif menggunakan uji Dot Blot Immunoassay dengan konsentrasi BSA di dalam antigennya sebesar 1.74 mg/mL. Serum darah kelinci berdasarkan uji Agar Gel Precipitation Test (AGPT) positif mengandung antibodi poliklonal anti aflatoksin B1 setelah dua pekan (hari ke-11) sejak imunisasi primer antigen AFB1-BSA dilakukan. Dari serum darah bleeding panen, diperoleh konsentrasi antibodinya sebesar sebesar 2.19 mg/mL. Immunokromatogafi strip tes berhasil dibuat dengan nanopartikel iridium oksida (IrO2 NPs) sebagai kandidat label antibodinya dan dapat digunakan untuk mendeteksi sampel H IgG pada rentang 0.1 μg/mL sampai 10 μg/mL. Studi pendahuluan ini menunjukkan bahwa perangkat strip tes ini dapat digunakan untuk aplikasi konjugat sensor antibodi anti aflatoksin B1-nanopartikel iridium oksida untuk deteksi aflatoksin B1.

---

ABSTRACT
Polyclonal antibody against aflatoxin B1 have been successfully produced in New Zealand White Rabbit after immunized by hapten of aflatoxin B1-CMO conjugated with Bovine Serum Albumin (BSA) as antigen. Hapten of aflatoxin B1-CMO was synthesized using carbodiimide method with afltoksin B1 as substrate and carboxymethyl hydroxylamine hemihydrochloride (CMO) as its linker. The characterization results of thin layer chromatography with Rf value of 0.395, the spectrum of UV-Visible with λ max peaks at 362, 264, 218 nm, the IR spectrum with peak at 3448.126 cm-1 (3000-3600 cm-1): OH , 1632.249 cm-1(1540-1725 cm-1): C = O, 1642.451 cm-1 (1640-1690 cm-1): C = N (oxime), and the results of mass spectrometry fragmentation (MS / MS) at m/ z of 386, 368.2, 310 proved that hapten of aflatoxin B1 -CMO successfully synthesized. Then, the hapten was conjugated to BSA to form antigen of aflatoxin B1-BSA (AFB1-BSA) before immunized to rabbits. The specificity of antigen of AFB1-BSA to its antibody and the confirmation of hapten-BSA conjugated showed positive results using dot blot immunoassay with BSA concentration in the antigen of 1.74 mg/mL. Based on Agar Gel Precipitation Test (AGPT) shown the rabbit blood serum resulted positive for polyclonal antibody against aflatoxin B1 after two weeks (day 11st) since the primary immunization of its antigen. From blood serum bleeding at harvest obtained the concentration of antibodies was 2.19 mg / mL. An Immunochromatogaphic test strip was successfully fabricated using iridium oxide nanoparticles (IrO2 NPs) as a labeled antibody candidate and can be used to detect the IgG H sample between of 0.1 μg/mL to 10 μg/mL. This preliminary study shown that the device can be used for applications of antibody against aflatoxin B1-nanoparticle iridium oxide conjugate for detection of aflatoxin B1 , Polyclonal antibody against aflatoxin B1 have been successfully produced in New Zealand White Rabbit after immunized by hapten of aflatoxin B1-CMO conjugated with Bovine Serum Albumin (BSA) as antigen. Hapten of aflatoxin B1-CMO was synthesized using carbodiimide method with afltoksin B1 as substrate and carboxymethyl hydroxylamine hemihydrochloride (CMO) as its linker. The characterization results of thin layer chromatography with Rf value of 0.395, the spectrum of UV-Visible with λ max peaks at 362, 264, 218 nm, the IR spectrum with peak at 3448.126 cm-1 (3000-3600 cm-1): OH , 1632.249 cm-1(1540-1725 cm-1): C = O, 1642.451 cm-1 (1640-1690 cm-1): C = N (oxime), and the results of mass spectrometry fragmentation (MS / MS) at m/ z of 386, 368.2, 310 proved that hapten of aflatoxin B1 -CMO successfully synthesized. Then, the hapten was conjugated to BSA to form antigen of aflatoxin B1-BSA (AFB1-BSA) before immunized to rabbits. The specificity of antigen of AFB1-BSA to its antibody and the confirmation of hapten-BSA conjugated showed positive results using dot blot immunoassay with BSA concentration in the antigen of 1.74 mg/mL. Based on Agar Gel Precipitation Test (AGPT) shown the rabbit blood serum resulted positive for polyclonal antibody against aflatoxin B1 after two weeks (day 11st) since the primary immunization of its antigen. From blood serum bleeding at harvest obtained the concentration of antibodies was 2.19 mg / mL. An Immunochromatogaphic test strip was successfully fabricated using iridium oxide nanoparticles (IrO2 NPs) as a labeled antibody candidate and can be used to detect the IgG H sample between of 0.1 μg/mL to 10 μg/mL. This preliminary study shown that the device can be used for applications of antibody against aflatoxin B1-nanoparticle iridium oxide conjugate for detection of aflatoxin B1 ]

Abstrak :
Aspergilli moulds were isolated from 27 Indonesian tobacco samples, which were collected from different areas in Indonesia. Isolation of moulds was carried out by direct plating in Tauge Extract Agar (TEA) medium and representative colonies were isolated. Identification was carried out in Czapek . Dox Agar (CDA) and Malt Extract Agar (MEA) media based on macroscopic and microscopic observation of colony morphology. Total aspergilli moulds identified were 44 isolates, which consisted of 11 species. Asp. awamori (14 isolates) was the dominant species followed by Asp. flavus (13 isolates). ......The capability of 13 isolates of Asp. flavus to produce aflatoxin B1 was investigated. The isolates were cultivated in a semisynthetic liquid medium for aflatoxin B1 production, followed by extraction with organic solvents and quantification by High Performance Liquid Chromatography (HPLC). The results showed that only 12 isolates were able to produce aflatoxin al and the average concentration ranged from 3.28 to 351.26 ppb.

Abstrak :
Telah dilakukan percobaan penyalutan tablet Vitami-B1 secara salut gula yang memakai 2 jenis gula da1am neger dengan membandingkan hasilnya dengan penyalutan menggunakan gula Import. Sebelum proses penyalutan,dilakukan pemeriksaan sifat fisik dari masing-masing gula dan formula tablet Vitamin B1 yang digunakan sebagai inti tab1et diperoleh dari Lembaga Farmasi TNI-AL. Sedangkan metoda penyalutan yang digunakan adalah metoda, penyalut dengan sistim penyemprotan Dari hasil percobaan, ternyata menggunakan gula lokal type SHS.I.A cukup baik seperti pada penyalutan tablet memakai gula Import. ......A c·o.:iting experiment of Vitamin Bi tablets has been performen to sugar c·oating process using two kinds of domestic sugars and the results with two that using orted sugar. Prior to the coating process a laboratory check of physical properties of each kind of the sugars has been carried out. The formula of Vitaniin B1 used as the basic component' of the tablets was taken from the Navy Phar rnaseuticaf Institute (LAFIAL). Whereas the method of coating being used was that of coating pan method with the spraying system. From the experiments it was found out that using the local sugar of SHS.I.A type gave good enough result compared to that using the imported sugar.

Abstrak :
Telaii dilakukan penentuan kadax' vitamin dalam tablet vitamin B kompleks dengan cara kolorimetri dan cara spektrofluorometri, dan penentuan kadar vitamin Bg dalam tablet vitamin B kompleks . dengan cara spektrofluorometri, cara kolorimetri untuk penentu an kadar vitamin ternyata tidak dapat dilakukan, karena Nicotinaraid akan ikut diendapkan bersama-sama vitamin B^ oleh am monium reineckat. Penentuan kadar denj^?an cara spektrolluorometri untuk vitamin dan vitamin fl^., ternyata mernberikan basil yang cukup memuaskan, tetapi pacia penentuan kadar vitamin Bp dengan cara spektrofluorometri konsuntrasi vitarnlii Bg bai'us dinaikkan 10 kali lebih besar dari prosedur semula» ......A determination of vitamin cdncentratioxi in vitamin B eoraplex tablets had been carried out with the Colorimetrio method and the Spectrofluorometric method, and a determination of vi tamin B2 concentration in vitamin B complex tablets v/ith the'~ ^ Spectrofluorometric method. The Goloriraetric method for the determination of vitamin concentration could not be put in to practice becauce the Kicotinarnide would also be precipitated together with vitamin by Ammonium Reineckat. A determination of concentration with the Spectrofluorometric method of vitamin B^ and vitamin Bg give evidence of a isatisfying result, but in the' determination of vitamin Bg concentration with the Spectro fluorometric method, the vitamin concentration had to be raised ten times from the original procedure.

Abstrak :
Toxoplasma gondii adalah protozoa intraselular yang dapat menyebabkan toksoplasmosis. Jenis pemeriksaan yang banyak dilakkukan untuk diagnosis toksoplasmosis pada saat ini adalah pemeriksaan serologi (enzyme-linked immunosorbent assay / ELISA) untuk medeteksi anti IgG dan Ig M terhadao T.gondii di dalam di dalam serum, namun pemeriksan serologi ini tidak adekuat. Oleh karena itu diperlukan pemeriksaan laboratorium yang tepat untuk mendiagnosis toksoplamosis akut, dan dalam hal ini PCR merupakan teknik yang terpilih. Penelitian ini bertujuan untuk menentukan konsentrai minimal DNA T. gondii yang masih dapat terdeteksi oleh PCR dengan menggunakan targaet gen B1 dan gen P30 T. gondii. PCR terhdap target gen B1 dilakukan menurut metode Chang & Ho dan gen P30 menurut metode Weiss dkk dan aligo 2:5'TCTTTAAAAGCGTTCGTG GTC3' Primer gen P30 terdiri dari oligo 1 : 5'CACACGGTTGTATGTCGGTTTCGCT3' dan oligo 2 : 5'TCAAGGAGCTCAATG TTACAG CCT3'. Pada penelitian ini PCR dengan target gen P30 yang dilakukan menurut metode Weiss dkk memberikan pita yang spesifik dan tidak spesifik. Pada metode Chang & Ho penggunaan siklus sebanyak 30, 35, 40, 45 siklus tidak memberikan gambaran pita, sedangkan penggunaan 50 siklur baru memberikan hasil pita spesifik T.gondii pada elektroforesis. Dapat disimpulkan bahwa uji yang menggunakan target gen B1 lebih sensitif dibandingkan dengan gen P30.

---

Toxoplasmagondii is an intracellular protozoan which causes toxoplasmosis. A serological test (ELISA) for detecting the presence of IgG and IgM antibodies against T.gondii is usuall performed nowadays, however this serological test is not adequate. Therefore an accurate laboratory test is neede for diagnosing acute toxoplasmosis and in this case the polymerase chain reaction (PCR) is the method of choice. The aim of this study is to assess the minimal concentration of the DNA of T.gondii which still can be detected by the PCR using B1 and P30 gene as targets.

Abstrak :
Polyclonal antibodies of aflatoxin B1 were successfully produced from New Zealand White female rabbits after immunization by the hapten of aflatoxin B1-carboxymethyl hydroxylamine hemihydrochloride (AFB1-CMO) conjugated with bovine serum albumin (BSA) as the antigen. The hapten was synthesized using the carbodiimide method with CMO as a linker. Absorption peaks at 362, 264, and 218 nm were observed as a result of characterization with UV-Vis spectroscopy, while IR spectroscopy showed peaks at 3448 cm-1 and 1642 cm-1 attributable to the hydroxyl and nitrile groups, respectively. Furthermore, mass spectrometry showed fragmentation at the m/z of 386, 368.2, and 310, which confirms that the hapten of AFB1-CMO was successfully synthesized. The hapten was then conjugated with BSA to serve as an antigen of AFB1 when it was injected into the rabbits. The specificity of the antigen towards its antibody and the confirmation of hapten-BSA conjugation were characterized using the dot blot immunoassay, which showed a BSA concentration of 1.74 mg/mL. Two weeks after the primary immunization by its antigen, agar gel precipitation testing showed that the rabbit blood serum had positive results for polyclonal antibodiest against AFB1 with the highest concentration of antibodiest of 2.19 mg/mL.

Sintesa of Poliklonal Antibodi Aflatoxin B1. Antibodi poliklonal aflatoksin B1 telah berhasil diproduksi pada hewan uji kelinci betina New Zealand White setelah diimunisasi dengan hapten aflatoksin B1-carboxymethyl hydroxylamine hemihydrochloride (AFB1-CMO) yang dikonjugasikan dengan bovin serum albumin (BSA) sebagai antigen. Hapten AFB1 disintesis menggunakan metode karbodiimida dengan CMO sebagai linker. Puncak absorbansi pada 362, 264, 218 nm teramati sebagai hasil karakterisasi menggunakan spektrofotometer UV-Visibel, sementara dengan spektrum IR diperoleh puncak pada 3448.126 cm-1 dan 1642.451 cm-1 yang masing-masing mengindikasikan adanya gugus hidroksil dan nitril. Hasil spektrometri massa menunjukkan fragmentasi pada m/z 386, 368.2, dan 310 yang membuktikan hapten AFB1-CMO telah berhasil disintesis. Hapten ini kemudian dikonjugasikan dengan BSA agar dapat berperan sebagai antigen AFB1 ketika diinjeksikan pada kelinci. Kekhususan antigen aflatoksin B1 terhadap antibodinya dan konfirmasi konjugat hapten-BSA menunjukkan hasil positif pada uji dot blot immunoassay dengan konsentrasi BSA sebesar 1.74 mg/mL. Dua pekan setelah imunisasi primer, agar gel precipitation test menunjukkan hasil positif terhadap antibodi poliklonal AFB1 dengan konsentrasi tertinggi sebesar 2.19 mg/mL.

Abstrak :
Ruang lingkup dan cara penelitian : Toxoplasma gondii adalah suatu protozoa yang hidup intraselular. Infeksi primer pada wanita hamil dapat menyebabkan abortus, kematian intrauterin dan kelainan kongenital pada. bayi, sedangkan pada penderita imunokompromais infeksi dapat berakibat fatal. Diagnosis toksoplasmosis biasanya dilakukan dengan pemeriksaan serologi, namun pemeriksaan ini tidak memuaskan, sedangkan pengobatan dini perlu dilakukan. Reaksi rantai polimerase (PCR) dengan target gen B1 dan gen P30 dengan cara ekstraksi DNA yang sederhana merupakan salah satu teknik yang dapat mengatasi masalah tersebut. Penelitian ini bertujuan untuk menentukan konsentrasi minimal DNA T.gondii yang masih terdeteksi dengan gen B1 dan gen P30. PCR dengan target gen B1 dilakukan pada berbagai konsentrasi DNA murni T.gondii yaitu : 5; 2,5; 1; 0,1; 0,01; 0,001; 0,0001 dan 0,00001 ng / 50 µl larutan PCR. Konsentrasi DNA murni T.gondii dalam DNA darah manusia sehat adalah 25; 10; 5; 2,5; 1; 0,1; 0,01; 0,001 dan 0,0001 ng / 50 µl larutan PCR. Berbagai jumlah takizoit dalam 100 µl darah manusia sehat adalah 1000; 100; 50; 40; 30; 20; 10; 5 dan 1 takizoit Untuk PCR dengan target gen P30 dipakai konsentrasi DNA murni T.gondii sebagai berikut : 1; 0,5; 0,25; 0,1; 0,01; 0,001 dan 0,0001 ng / 50 µl larutan PCR. Konsentrasi DNA murni T.gondii dalam DNA manusia sehat adalah : 10; 5; I; 0,25; 0,05; 0,01; 0,025 ng / 50 pl larutan PCR; serta jumlah takizoit dalam 100 µl darah manusia sehat adalah 1000; 100; 50; 40; 30; 20 dan 10. Hasil dan kesimpulan : Dengan cara ekstraksi DNA sederhana konsentrasi minimal DNA T.gondii yang masih terdeteksi dengan target gen B1 adalah 0,0001 ng , untuk campuran DNA murni dengan DNA manusia sehat 0,001 ng dan untuk campuran darah manusia sehat dengan suspensi takizoit DNA dari 1 takizoit dengan target gen P30 terdeteksi DNA murni 0,001 ng, untuk campuran DNA murni dengan DNA manusia sehat 0,025 ng dan untuk campuran darah manusia sehat dengan suspensi takizoit DNA dari 20 takizoit. Kesimpulan :
1. Dengan cara ekstraksi sederhana uji dengan target gen B1 lebih sensitif dari gen P30.
2. Jumlah siklus yang diperlukan pada penelitian ini adalah 50 siklus.