Hasil Pencarian  ::  Simpan CSV :: Kembali

Abstrak :
Upaya peningkatan kualitas sumber daya manusia aparatur pemerintah, melalui pendidikan dan pelatihan bertujuan untuk meningkatkan pengetahuan, keterampilan dan sikap perilaku di dalam melaksanakan tugas pemerintahan umum dan pembangunan. Tuntutan peningkatan profesionalisme di jajaran aparatur pemerintah itu menjadi sangat penting dan mutlak seiring dengan semakin meluasnya era globalisasi. Oleh karenanya sistem dan program pendidikan dan pelatihan khususnya pendidikan dan pelatihan jabatan Pegawai Negeri Sipil harus benar-benar secara efektif dapat memberikan kontribusi terhadap meningkatnya fungsi dan keprofesionalan birokrasi dalam melayanai masyarakat secara transparan, akuntabel dan bebas dari penyalahgunaan kekuasaan. Adapun untuk mengetahui efektivitas pelaksanaan pendidikan dan pelatihan, maka harus dilakukan evaluasi sebagai salah satu tahapan penting dalam proses pendidikan dan pelatihan. Evaluasi efektivitas pelaksanaan pendidikan dan pelatihan menurut pendekatan model Kirkpatrick terdiri dari empat tingkatan yaitu, efektivitas reaksi, efektivitas pembelajaran yang merupakan evaluasi internal dan efektivitas perilaku serta efektivitas hasil (dampak) yang merupakan evaluasi eksternal. Berdasarkan kerangka pemikiran tersebut diatas, maka penelitian ini akan menguji efektivitas pelaksanaan pendidikan dan pelatihan (Diklatpim Tingkat III di Departemen Kehakiman dan HAM tahun 2003) dengan evaluasi internal yaitu evaluasi efektivitas reaksi dan evaluasi efektivitas pembelajaran. Evaluasi efektivitas reaksi merupakan pengukuran efektivitas pendidikan dan pelatihan berdasarkan persepsi peserta pendidikan dan pelatihan terhadap aspek kurikulum, widyaiswara, penyelenggara dan aspek sarana prasarana. Sedangkan evaluasi efektivitas pembelajaran merupakan efektivitas yang diukur berdasarkan prestasi belajar peserta yang berkaitan derigan penguasan berbagai konsep, fakta yang diajarkan dalam pendidikan dan pelatihan selama periode tertentu. Untuk memperoleh data berdasarkan persepsi, tehnik pengumpuian data dilakukan dengan membuat kuesioner kepada peserta dengan tehnik purposive sampling yaitu menentukan sampel dari peserta Diklatpim Tingkat III di Jakarta sebanyak 48 responden. Sedangkan untuk memperoleh data tentang prestasi belajar peserta dilakukan dengan menggunakan pre-test dan post-test terhadap peserta Diklatpim Tingkat III tahun 2003. Berdasarkan hasil pengolahan data, dari tanggapan peserta terhadap aspek-aspek pelaksanaan pendidikan dan pelatihan yang diukur, maka pelaksanaan Diklatpim Tingkat III yang diselenggarakan oleh Pusdiklat Pegawai Departemen Kehakiman dan HAM secara umum berjalan secara efektif. Meskipun demikian, terhadap reaksi responden yang menyatakan berimbang diperlukan penyempurnaan dan penyesuaian terhadap setiap komponen kebutuhan pelaksanaan pendidikan dan pelatihan. Dari peringkat reaksi peserta yang berimbang tersebut, yaitu aspek widyaiswara, sarana dan prasarana, maka hendaklah menjadi prioritas penyempurnaan atau perbaikan. Sedangkan, dari hasil pengolahan data terhadap hasil pembelajaran, kendatipun terdapat peningkatan pengetahuan dari peserta, namun belum mencerminkan keberhasilan yang memuaskan. Dari hasil penelitian menunjukan bahwa kegiatan evaluasi Diklatpim Tingkat III tahun 2003 sudah dilaksanakan, namun hasilnya belum sepenuhnya dijadikan sebagai bahan perbaikan. Sehubungan dengan hal tersebut, hasil penelitian ini merekomendasikan perlunya dilakukan perbaikan dan penyempurnaan pada komponen-komponen di setiap aspek yang masih belum memadai ketersediaannya serta perlunya studi evaluasi secara lebih terfokus terhadap proses pembelajaran pendidikan dan pelatihan guna memperoleh hasil keluaran peserta pendidikan dan pelatihan yang benar-benar memiliki kemampuan, keterampilan sesuai dengan tujuan dan sasaran yang ditetapkan dalam pendidikan dan pelatihan yang bersangkutan.

---

The Evaluation Study For The Effectiveness of The Leadership Grade III Training in Department of Justice and Human RightThe effort of enhancing human resources quality among government apparatus by way of education and training is aimed to improve their knowledge, skill and attitude in executing their assignment in development field and public service. The demand for enhancing their professionalism is absolutely important side aside by the widening Globalization Era. Therefore, system and programme of education and training especially Leadership Training for Government Employees must be extremely effective in obtaining transparently and accountably birocracy functions and professionalism in which it is also free from corrupt- in serving public matters. To know how effectiveness of the training is, that evaluation should be done as it is one important level in training process. The evaluation of training execution as Kirkpatrick's Four Level Evaluation Model, these steps can be defined as follows : The Effectiveness of Reaction, The Effectiveness of Learning which is an Internal Evaluation, The Effectiveness of Behavior, and The Effectiveness of Result which is an External Evaluation. Based on the paradigm, the experiment would examine the effectiveness of The Training and Education (Diklatpim Tingkat Ill) on Department of Justice and Human Right 2003 by a way of Internal Evaluation Measurements, there were the Evaluation of Reaction and the Evaluation of Learning. The Evaluation in terms of Reaction is the same as measuring the feeling of conferees to Curriculum Aspect, Expert (Widyaiswara) Aspect, Organized Committee Aspect and Facilities Aspect. The Evaluation of Learning is defined as measurement effectivity based on learning appreciation of conferees related to their understandings in concepts and facts studied during the training on the certain period. To obtain the objective data based on perception, data finding method was done by distributing questionnaires to the trainees in the form of Purposive Sample that was determining samples from the trainees of Leadership Grade Ill Training (Diklatpim Tingkat III) held in Jakarta as many as 48 respondents. Moreover, learning appreciation data from the participants was done by executing pre-test and post-test to them. Based on the processing data result, from which the trainees responded to the measured aspects of the training as whole, finally the training which was held by The Education and Training Centre of Department of Justice and Human Right was generally running effectiveness. To those respondents reaction who determined equal, even though, we needed to complete and adapt every component of the training needs. Here, Experts (Widyaiswara) aspect and facilities aspect should become a priority of reconstruction and completing factors. Although, it had not reflected a satisfied goal of the data processing result to the learning result, in fact the knowledge of the conferees as a whole were obviously enhanced. From the result indicating that the evaluation of the Leadership Grade III Training 2003 had been well done, even though the result had entirely not become reconstruction matters. Relating to the subject, the result of this experiment recommended the need of reconstructions and completing to the insufficient components of every aspect and the need of evaluation study which is more focused to the learning process of the training to produce capable and skillful participants fitted by the aim and the objective of the training.

Abstrak :
RSPAD GS adalah rumah sakit militer tingkat I yang menjadi pusat rujukan tertinggi dari RS TNI AD/ABRI, melayani pasien baik sebagai anggota ABRI, PNS ABRI beserta keluarganya, juga melayani para pejabat tinggi dan tertinggi, dan masyarakat umum. Salah satu fasilitas layanan yang penting adalah bedah sentral, selain keberadaannya sangat dibutuhkan, bila dikelola dengan baik, bedah sentral akan menjadi salah satu sumber penghasilan bagi rumah sakit yang bersangkutan. Rendahnya kinerja di Bagian Bedah Sentral RSPAD GS, akan berpengaruh terhadap kesempatan menambah penghasilan bagi RSPAD GS. Untuk dapat mengoptimalkan peran bedah sentral dalam rangka meningkatkan pendapatan rumah sakit perlu dilakukan penelitian studi kasus dengan analisis kuantitatif dibantu dengan Competing values Framework. Tujuan penelitian adalah untuk mengetahui budaya organisasi Bagian Bedah Sentral RSPAD GS kaitannya dengan kinerja Bagian Bedah Sentral RSPAD GS. Pengumpulan data dilakukan secara survei dengan bantuan kuesioner, besar sampel 89, dan semua populasi di Bagian Bedah Sentral dipilih sebagai responden. Data yang terkumpul dilakukan analisa dengan melihat kecenderungan budaya organisasi sekarang dan yang diinginkan. Dati hasil penelitian budaya sekarang dan budaya yang diinginkan oleh kelompok manajemen di tingkat rumah sakit adalah budaya tipe klan, menurut kelompok manajemen di tingkat unit dan kelompok pengguna kamar bedah sentral, adalah budaya tipe hirarki. Penelitian ini menyimpulkan bahwa kelompok manajemen di tingkat rumah sakit, kelompok manajemen di tingkat unit dan kelompok pengguna kamar bedah sentral di bagian bedah sentral RSPAD GS tidak memiliki persepsi yang sama terhadap budaya organisasi di bagian bedah sentral dan masing-masing kelompok tersebut mempunyai harapan budaya organisasi yang berbeda. Peneliti berasumsi bahwa perbedaan harapan tersebut yang selama ini menyebabkan rendahnya kinerja dibagian bedah sentral RSPAD GS. Bagian bedah sentral di RSPAD GS apabila ingin meningkatkan kinerjanya sebaiknya menyamakan budaya diantara kelompok manajemen di tingkat rumah sakit, kelompok manajemen di tingkat unit dan kelompok medis pengguna kamar bedah agar sejalan dengan visi, misi, strategi dan budaya di bagian bedah sentral RSPAD GS.

---

Cultural View Of The Main Operating Theatre Of The Gatot Subroto Army Main Hospital RSPAD 2003RSPAD GS is a first class Military Hospital which has become the main referral hospital for other military hospital, providing services for members of the Indonesian Armed Forces (TNI), civilian personnel of the armed forces as well as their families also for high ranking members of the military as well as that of the high and highest level of official and general public. One of the important services is the Main Operating Theatre. Its presence is extremely needed and if it is well managed, the Main Operating Theatre can become one of the main sources of revenue for the hospital. The low performance of the Main Operating Theatre of RSPAD GS will have an impact on the opportunity to make extra revenue for RSPAD GS. In order to maximize the role of the main Operating Theatre so as to raise revenue of the hospital, it is necessary to hold a survey as a case study by using the method of Quantitative analysis with the help of competing value framework. The aim of the survey is to find out the Organizational Culture of the Main Operating Theatre of RSPAD GS and its connection with performance of the Main Operating Theatre of RSPAD GS. Search for data can be done in a curve' with the help of questionnaires, the amount of samples is 89, conducted to all the personnel at the Main Operating Theatre who will be selected as respondents. The collected data can be analyzed by observing the current culture and the one desired by the Management Group a the hospital level there is the Clan Type of Culture, and according to the management group at the unit level and group using the Main Operating Theatre it is the Hierarchy type of culture. The survey concluded that the Management at the hospital level, the management group at unit level and the group using the main operating theatre of the RSPAD GS do not have the same perception about the organizational culture of the main operating theatre and each group has its own different organizational cultural expectation. The writer assume that these different organizational culture expectation is responsible for the low performance of the main operating theatre. The main operating theatre at RSPAD GS when it wishes to improve its performance should have similar cultural view between the management group at the hospital level, the management group at the unit level and the group using the main operating theatre so that they will have similar vision, mission, strategy and culture at the main operating theatre.

Abstrak :
Demam berdarah merupakan sebuah masalah kesehatan besar yang mengancam banyak negara tropis, termasuk Indonesia. Beberapa tahun terakhir penyakit ini berkembang menjadi semakin parah. Hal ini diperparah dengan tidak adanya antivirus maupun Vaksin untuk infeksi dengue. Penelitian ini bertujuan untuk melakukan desain primer untuk amplifikasi gen Non Structural -3 (NS-3) serotype 2 (DENV-2) strain Indonesia (AB189124) yang bisa disisipkan pada plasmid pPICZ-alphaA dan diekspresikan pada vektor Pichia pastoris. Hasil penelitian didapatkan pasangan primer yang dapat digunakan untuk membuat protein rekombinan NS-3 DENV-2. Pasangan primer tersebut adalah pasangan CGC + KpnI + Primer (4468) = CGC + GGTACC + TCCCGTGTCAATACCAATCA dan SacII + Primer (6495) = CCGCGG + AGCATGATTGTACGCCCTTC. Dengan mempertimbangkan sekuens keseluruhan gen NS-3 DENV-2, epitope, dan enzim restriksi pada plasmid dan NS-3, maka pasangan primer tersebut dapat digunakan untuk membuat protein rekombinan NS-3 DENV-2 sebagai kandidat Vaksin dengue. ......Dengue Fever is a major health problem which threatens a lot of tropical countries, including Indonesia. In the last few years, this epidemic grew worse. This was aggravated by the nonexistence of neither vaccine nor antivirus capable of neutralizing dengue virus serotype 1-4. This research focused on designing primer for amplification of Non Structural-3 (NS-3) dengue virus serotype 2 (DENV-2) Indonesian strain (AB189124) which could be spliced into pPICZ-alhpaA and expressed on Pichia pastoris vector. Research result was a primer pair which could be used to produce NS-3 DENV-2 recombinant protein. These primer pair were CGC + KpnI + Primer (4468) = CGC + GGTACC + TCCCGTGTCAATACCAATCA dan SacII + Primer (6495) = CCGCGG + AGCATGATTGTACGCCCTTC. By considering overall sequence of NS-3 DENV-2 genes, epitope, and restriction enzyme on plasmid and NS-3, these primer pair could be use to produce NS-3 DENV-2 recombinant protein as a dengue vaccine candidate.