Hasil Pencarian  ::  Simpan CSV :: Kembali

"Latar Belakang : Neuronal ceroid lipofuscinoses (NCL) tipe 2 adalah kelompok penyakit langka yang diturunkan, bersifat autosomal resesif, dan progresif neurodegeneratif. Penyakit NCL tipe 2 disebabkan oleh mutasi pada gen TPP1 dengan prognosis buruk. Penyakit ini dapat diterapi dengan terapi sulih enzim yang mahal. Dengan melakukan carrier testing kita dapat melihat pembawa sifat dalam keluarga. Informasi tersebut berguna dalam mencegah keturunan berikut menjadi sakit dengan preimplantation genetic diagnosis (PGD). Salah satu teknik PGD adalah preimplantation genetic testing for monogenic disorder (PGT-M) dengan validasi analisis linkage dari short tandem repeat (STR). Tujuan penelitian ini untuk mendapatkan profil STR pada keluarga pasien NCL tipe 2 di Indonesia untuk persiapan PGD.

Metode : Penelitian ini merupakan suatu studi observasional analitik pada keluarga pasien dengan NCL tipe 2 yang sudah terkonfirmasi secara enzimatik dan genetik. Carrier testing dilakukan pada kedua orang tua dan saudara kandung subjek, dilanjutkan pencarian STR pada area  ± 1 Mb dari gen TPP1. Pada setiap kandidat STR dilakukan fragment analysis pada subjek, kedua orang tua dan saudara kandung, serta dilakukan linkage analysis untuk menilai penanda STR bersegregasi dalam keluarga dan dapat digunakan sebagai kandidat dalam PGT.

Hasil Penelitian : Terdapat 4 pasien dari 4 kota di Indonesia. Terdiri dari satu lelaki dan tiga perempuan. Keempat subjek menunjukkan gejala NCL tipe 2 klasik dengan awitan gejala usia 31-42 bulan. Ditemukan 3 varian patologis yaitu 1 varian frame-shift (c.583_584insTACA), 1 varian in-frame (c.1222_1224delAGT), dan 1 varian missense (c.679T>C). Hasil carrier testing menunjukkan semua orang tua sebagai carrier varian patogenik. Hasil fragment analysis dari dua buah STR D11S1996 dan D11S1338 menunjukkan segregasi dalam linkage analysis dalam keluarga subjek.

Kesimpulan : Pada keempat pasien NCL tipe 2 di Indonesia ditemukan 3 varian patogenik. Carrier testing menunjukkan semua orang tua adalah pembawa sifat. Kedua STR D11S1996 dan D11S1338 dapat dipakai dalam program PGD pada pasien NCL tipe 2 di Indonesia.

---

Background : Type 2 Neuronal Ceroid Lipofuscinoses (NCL) is a type of autosomal recessively inherited and progressive neurogenerative rare disease. This disease is due to TPP1 gene mutation, which have poor prognosis. Enzyme replacement therapy is available but with high cost. Carrier trait individual can be detected by carrier testing procedure, such as pre-implantation genetic diagnosis (PGD). These information can be useful to prevent disease occurence on subsequent generation. One PGD technique currently used is pre-implantation genetic testing for monogenic disorder (PGT-M) with linkage validation analysis of short tandem repeat (STR). The aim of this study was to search for STR marker in the type 2 NCL family in Indonesia for the preparation of PGD.

Methods : This is an analytical observational study on patient's family with enzymatic and genetically confirmed case of type 2 NCL. Carrier testing were done on both parents and sibling of case patients. STR sequence testing were done on ± 1 Mb area of TPP1 gene, with fragment analysis on each STR candidate. Linkage analysis were also performed to look for segregated STR pattern on the family, which can be used as a candidate in PGD.

Result : There were four case patients from 4 cities in Indonesia, 1 male and 3 female cases. These four cases manifested classic symptoms of type 2 NCL with onset age ranging from 31-42 months. Three pathological variants were found: 1 frame-shift variant (c.583_584insTACA), 1 in-frame variant (c.1222_1224delAGT), and 1 missense variant (c.679T>C). Carrier testing results showed all parents as pathogenic variant carrier. Fragment analysis from 2 STR (D11S1996 and D11S1338) showed segregation in linkage analysis on subject's family.

Conclusion : From 4 type 2 NCL cases in Indonesia, 3 pathogenic variants were found, with carrier testing showed both of their parents as carriers. Both D11S1996 and D11S1338 STR can be utilized as PGD diagnostic of type 2 NCL patients in Indonesia."

"

Pendahuluan: Kelainan kromosom meningkat secara eksponensial pada ibu usia lanjut dan prevalensi dapat mencapai hingga 80% pada wanita usia 40 tahun. Oleh karena itu, PGT-A telah digunakan di rumah sakit pada pasien IVF, untuk mencegah konsekuensi yang timbul dari kelainan genetik dan mengoptimalkan hasil klinis. Faktor ibu dan faktor laki-laki yang berhubungan dengan kesuburan telah dikaitkan dengan penemuan embrio aneuploid di PGT-A, namun data masih sedikit. Tujuan penelitian ini adalah menganalisis pengaruh usia ibu, penilaian embrio, konsentrasi sperma, dan motilitas sperma pasangan terhadap hasil PGT-A. Metode: Penelitian cross-sectional ini menggunakan data rekam medis dan buku embriologi Klinik Yasmin Kencana. Sebanyak 35 pasien IVF dengan embrio tunggal yang telah menjalani PGT-A dianalisis menggunakan uji Kruskal Wallis untuk kemungkinan pengaruh usia ibu, penilaian embrio, konsentrasi sperma, dan motilitas sperma pasangan, terhadap hasil PGT-A. Untuk mengidentifikasi faktor terkuat yang terkait dengan tingkat aneuploidi, dilakukan analisis regresi logistik multivariat. Hasil: Usia ibu (p=0,033), penilaian embrio (p=0,002), konsentrasi sperma (p=0,002) dan motilitas sperma (p=0,008), memiliki hubungan yang signifikan secara statistik dengan hasil PGT-A. Faktor terkuat dalam memprediksi hasil PGT-A pasien IVF adalah penilaian embrio (B=0.593, OR=1.809, 95% CI, 0.286-0.683, p<0.001). Kesimpulan: Penelitian ini menemukan bahwa usia ibu, penilaian embrio, konsentrasi sperma dan motilitas sperma mempengaruhi hasil PGT-A.

---

Introduction: Chromosomal abnormality increases exponentially in advanced maternal age and reaches up to 80% prevalence in women ages 40. For this reason, PGT-A has been utilized in hospital settings for IVF patients, to prevent consequences arising from genetic anomalies and optimize clinical outcomes. Maternal factors and fertility-related male factors have been associated with finding an aneuploid embryo in PGT-A, yet data remain scant. The aim of this study was to analyze the influence of maternal age, embryo grading, partner’s sperm concentration and sperm motility on PGT-A results. Method: This cross-sectional study used data from Yasmin Kencana Clinic medical record and embryology book. A total of 35 single-embryo IVF patients who had undergone PGT-A were analyzed using the Kruskal Wallis test, for the possible influence of maternal age, embryo grading, partner’s sperm concentration and sperm motility on PGT-A results. For the identification of the strongest factor associated with aneuploidy rates, multivariate logistic regression analysis was performed. Results: Maternal age (p=0.033), embryo grading (p=0.002), sperm concentration (p=0.002) and sperm motility (p=0.008), have a statistically significant relationship with the PGT-A results. The strongest factor in predicting PGT-A results of IVF patients is embryo grading (B=0.593, OR=1.809, 95% CI, 0.286- 0.683, p<0.001). Conclusion: This study found that maternal age, embryo grading, sperm concentration and sperm motility influence PGT-A results.

"

"Demam berdarah merupakan sebuah masalah kesehatan besar yang mengancam banyak negara tropis, termasuk Indonesia. Beberapa tahun terakhir penyakit ini berkembang menjadi semakin parah. Hal ini diperparah dengan tidak adanya antivirus maupun Vaksin untuk infeksi dengue. Penelitian ini bertujuan untuk melakukan desain primer untuk amplifikasi gen Non Structural -3 (NS-3) serotype 2 (DENV-2) strain Indonesia (AB189124) yang bisa disisipkan pada plasmid pPICZ-alphaA dan diekspresikan pada vektor Pichia pastoris. Hasil penelitian didapatkan pasangan primer yang dapat digunakan untuk membuat protein rekombinan NS-3 DENV-2. Pasangan primer tersebut adalah pasangan CGC + KpnI + Primer (4468) = CGC + GGTACC + TCCCGTGTCAATACCAATCA dan SacII + Primer (6495) = CCGCGG + AGCATGATTGTACGCCCTTC. Dengan mempertimbangkan sekuens keseluruhan gen NS-3 DENV-2, epitope, dan enzim restriksi pada plasmid dan NS-3, maka pasangan primer tersebut dapat digunakan untuk membuat protein rekombinan NS-3 DENV-2 sebagai kandidat Vaksin dengue.

---

Dengue Fever is a major health problem which threatens a lot of tropical countries, including Indonesia. In the last few years, this epidemic grew worse. This was aggravated by the nonexistence of neither vaccine nor antivirus capable of neutralizing dengue virus serotype 1-4. This research focused on designing primer for amplification of Non Structural-3 (NS-3) dengue virus serotype 2 (DENV-2) Indonesian strain (AB189124) which could be spliced into pPICZ-alhpaA and expressed on Pichia pastoris vector. Research result was a primer pair which could be used to produce NS-3 DENV-2 recombinant protein. These primer pair were CGC + KpnI + Primer (4468) = CGC + GGTACC + TCCCGTGTCAATACCAATCA dan SacII + Primer (6495) = CCGCGG + AGCATGATTGTACGCCCTTC. By considering overall sequence of NS-3 DENV-2 genes, epitope, and restriction enzyme on plasmid and NS-3, these primer pair could be use to produce NS-3 DENV-2 recombinant protein as a dengue vaccine candidate."

"Dataset yang digunakan pada penelitian ini didapat dari paper yang berjudul “Attenuated total reflection FTIR dataset for identification of type 2 diabetes using saliva” yang ditulis oleh Sanchez-Brito et al. pada tahun 2022. Dataset tersebut berhubungan dengan spektrum ATR-FTIR dari 1040 saliva pasien. Dataset ini kemudian digunakan pada penelitian ini untuk melatih suatu model Machine Learning menggunakan algoritma SVM dan XGBoost. Sebelum dijadikan dataset acuan untuk keperluan pelatihan model, data terlebih dahulu melalui proses pre-processing yang meliputi proses pemotongan data agar terfokus pada region Biological Fingerprint, normalisasi protein amida I, dan penurunan orde satu. Untuk keperluan cross validation, dataset terlebih dahulu dipisah menjadi data train dan data test, kemudian data train akan kembali dipisah menjadi subset train untuk tiap fold dan subset validation yang dilatih sambil melewati stratified cross validation sebanyak 10 fold. Performa model akan didapat dari hasil prediksi model terhadap subset validation yang dihasilkan di semua 10 fold, serta hasil prediksi model terhadap data test yang menunjukkan performa keseluruhan model. Didapat bahwa performa model XGBoost melampaui performa model SVM dengan nilai accuracy sebesar 91,8%; sensitivity sebesar 93,6%; dan specificity sebesar 89,9%. Performa ini berhasil mendekati performa metode diagnosis diabetes tipe 2 yang masih bersifat invasif, yaitu tes HbA1c.

---

The dataset used in this study was obtained from the paper titled “Attenuated Total Reflection FTIR Dataset for Identification of Type 2 Diabetes Using Saliva” written by Sanchez-Brito et al. in 2022. This dataset pertains to the ATR-FTIR spectrum of saliva from 1040 patients. It was used in this research to train a machine learning model using the SVM and XGBoost algorithms. Before being used as a reference dataset for model training, the data underwent preprocessing, which included data trimming to focus on the Biological Fingerprint region, protein amide I normalization, and first-order derivative processing. For cross-validation purposes, the dataset was first split into training and testing data. The training data was further divided into train and validation subsets for each fold and trained using 10-fold stratified cross-validation. The model's performance was evaluated based on predictions on the validation subsets from all 10 folds, as well as predictions on the test data, reflecting the overall model performance. It was found that the XGBoost model outperformed the SVM model with an accuracy of 91.8%, sensitivity of 93.6%, and specificity of 89.9%. This performance approaches that of the invasive HbA1c test used for diagnosing type 2 diabetes."

"Mukopolisakaridosis tipe II MPS II atau Sindrom Hunter merupakan salah satu kelainan penyimpanan lisosomal yang disebabkan oleh mutasi atau perubahan susunan basa nitrogen pada gen Iduronat 2-Sulfatase gen IDS. Mutasi tersebut dapat terjadi di berbagai lokasi ekson yang berbeda. Penelitian ini bertujuan untuk mengetahui adanya mutasi yang terjadi pada ekson 2 dan 5 gen IDS pada penderita MPS II, khususnya di Indonesia. Analisis dilakukan dengan menggunakan 9 sampel DNA penderita MPS II asal Indonesia dan 50 kontrol yang terdiri atas 25 individu normal berjenis kelamin laki-laki maupun perempuan. Analisis dilakukan dengan melewati tahapan isolasi DNA, amplifikasi Polymerase Chain Reaction PCR, visualisasi elektroforesis dan sekuensing. Hasil penelitian menunjukkan bahwa gen IDS dari keseluruhan sampel yang digunakan berhasil dianalisis namun tidak ditemukan adanya mutasi yang terjadi pada daerah ekson 2 dan 5 penderita MPS II di Indonesia.

---

Mucopolysaccaridosis Type II MPS II or Syndrome Hunter is one of lysosomal storage disorder caused by mutation or changes of nitrogen base arrangement in IDS gene. This mutation can occur in various different exon locations. This research is aimed to recognize the presence of mutation that occur at exon 2 and 5 of gen IDS of MPS II patient, especially in Indonesia. Analysis was conducted by using 9 DNA MPS II patient samples of Indonesia origin and 50 controls that consists of 25 normal individual of male or female. Analysis was done by going through steps of DNA isolation, amplification by Polymerase Chain Reaction PCR, electrophoresis visualization, and sequencing. Research result shows that IDS gene from the whole samples used were successfully analysed, however there is no mutation found that occurred at exon 2 and 5 MPS II patients in Indonesia."

"Latar Belakang: Peningkatan prevalensi penderita diabetes melitus (DM) meningkatkan risiko aterosklerosis arteri karotis interna (internal carotid artery, ICA). Di negara maju, 85% kasus stroke terjadi akibat aterosklerosis karotis. Short chain fatty acid (SCFA) adalah produk metabolisme bakteri yang terutama disintesis di usus besar dan berperan mengurangi aktivasi endotel oleh mediator proinflamasi. Sehingga mencegah progresi aterosklerosis ICA. Penelitian ini bertujuan mengetahui hubungan SCFA feses dengan gambaran ultrasonografi ICA pada penderita DM tipe 2 di RS Dr. Cipto Mangunkusumo (RSCM).Metode: Desain penelitian ini adalah observasional analitik jenis potong lintang. Data diperoleh dari seluruh pasien DM tipe 2 di Divisi Bedah Vaskular dan Endovaskular RSCM. Meliputi kadar SCFA sampel feses dan gambaran ultrasonografi (carotid intima-media thickness (IMT), diameter lumen, peak systolic velocity (PSV), end diastolic velocity (EDV), dan flow volume). Uji korelasi Spearman dilakuan untuk memperoleh koefisien korelasi. Nilai p <0,05 bermakna signifikan.Hasil: Dari 30 subjek DM tipe 2, terdapat 12 laki-laki (40,0%) dan setengah populasi berusia >60 tahun. Hasil pemeriksaan IMT berhubungan signifikan dengan jenis kelamin (p=0,048). Kadar SCFA berhubungan signifikan dengan usia, yaitu asetat (p=0,029), proprionat (p=0,005), butirat (p=0,039), dan SCFA total (p=0,024). Kadar SCFA valerat berkorelasi signifikan dengan IMT (r = -0,237; p=0,034) dan diameter lumen (r = -0,243; p=0,031).Kesimpulan: Kadar SCFA feses berkorelasi dengan gambaran ultrasonografi arteri karotis interna. Nilai kadar SCFA feses pada pasien DM tipe 2 di RSCM lebih tinggi dibandingkan penelitian lain. Peningkatan kadar SCFA menurunkan risiko penyempitan arteri sklerosis interna

---

Background: The increasing prevalence of diabetes mellitus (DM) increases the risk of atherosclerosis of the internal carotid artery (ICA). In developed countries, 85% of stroke cases occur due to carotid atherosclerosis. Short-chain fatty acids (SCFA) are products of bacterial metabolism which are mainly synthesized in the large intestine and play a role in reducing endothelial activation through pro-inflammatory mediators, thus preventing the progression of ICA atherosclerosis. This study aims to determine the correlation between faecal SCFA and ICA ultrasonography in patients with type 2 diabetes at Dr. Cipto Mangunkusumo General Hospital (CMGH).

Methods: This study is cross-sectional. Data were obtained from all type 2 DM patients in the Vascular and Endovascular Surgery Division. Data that were collected included faecal SCFA levels and ultrasonography examination (carotid intima-media thickness (IMT), lumen diameter, peak systolic velocity (PSV), end-diastolic velocity (EDV), and flow volume). Spearman correlation test was conducted to obtain the correlation coefficient. The p-value <0.05 was significant.

Results: Of the 30 subjects, 12 were male (40.0%) and half the population was >60 years old. BMI examination results were significantly related to gender (p=0.048). SCFA levels were significantly related to age, including acetate (p=0.029), proprionate (p=0.005), butyrate (p=0.039), and total SCFA (p=0.024). SCFA valerate levels were significantly correlated with BMI (r = -0.237; p=0.034) and lumen diameter (r = -0.243; p=0.031).

Conclusion: Fecal SCFA levels correlated with ultrasound images of the internal carotid artery. The value of faecal SCFA levels in type 2 DM patients at CMGH was higher than in other studies. Elevated SCFA levels decrease the risk of ICA narrowing or stenosis."

"Latar Belakang: Faktor resiko terbesar Diabetik foot ulcer DFU adalah neuropati. Gen Vascular endothelial growth factor VEGF 7 merupakan gen yang mengkode protein Vascular Endothelial Growth Factor VEGF memiliki fungsi angiogenesis dan neurogenesis. VEGF berperan pada patogenesis terjadinya neuropati, angiopati dan penyembuhan luka karena trauma. Metode Penelitian: Penelitian case control study, kasus diambil dari penderita DM tipe 2 dengan DFU dan kontrol dari DM tipe 2 tanpa DFU, dilakukan Polimerase Chain Reaction Restriction Fracment lenght Polymorphism PCR-RFLP untuk melihat genotipe gen VEGF, analisis statistik menggunakan SPSS 20. Hasil: Genotip mutan GG gen VEGF 405C>G tidak memiliki hubungan bermakna dengan terjadinya DFU pada penderita DM di RSCM GG CG/CC ; OR; 0,52, 95 CI; 0,15-1,73 p; 0,289. Alel G; kemungkinan sebagai faktor protektif OR;0,86, 95 CI 0,57-1,28 dan p;0,456. Genotip mutan TT gen VEGF -460 C>T; tidak memiliki hubungan yang bermana dengan DFU TT CT/CC ; OR; 0,97, 95 CI; 0,41-2,26 dan p; 0,942. Alel T kemungkinan sebagai faktor protektif OR;0,90, 95 CI; 0,59-1,37 dan p;0,641. Kesimpulan: Genotip GG dan TT tidak memiliki hubungan yang bermakna dengan penyakit DFU, alel G dan alel T kemungkinan sebagai faktor protektif terhadap terjadinya DFU pada penderita DM Tipe 2.

---

Background: The greatest risk factor for Diabetic foot ulcer DFU is neuropathy. Vascular endothelial growth factor VEGF gene is a gene encodes a protein vascular endothelial growth factor VEGF, which has function of angiogenesis and neurogenesis. VEGF play a role in neuropathy, angiopathy and wound healing in DFU.

Methods: Case control study, case is type 2 DM with DFU and control is type 2 DM without DFU, Polymerase Chain Reaction Restriction Fracment lenght polymorphism was done to find genotype polymorphism of VEGF gene.

Results: Genotype GG VEGF 405C G does not have a significan association with DFU in DM patients GG CG CC OR 0.52, 95 CI 0.15 to 1.73 p 0.289. G allele is proposed as protective factor in DFU OR 0.86, 95 CI 0.57 to 1.28, and p 0.456. Genotype TT from VEGF gene 460 C T have no significant association with DFU TT CT CC OR 0.97, 95 CI 0.41 to 2.26 and p 0.942. T allele is predicted as protective factor in DFU OR 0.90, 95 CI 0.59 to 1.37 and p 0,641.

Conclusion: G alles and T alleles are predicted as a protective factors in DM patients associated with DFU."

"Achilles tendinopathy merupakan sebuah penyakit degeneratif yang dapat disebabkan oleh diabetes mellitus tipe 2 (DMT2). Penyakit ini disebabkan oleh akumulasi dari advanced glycation end products (AGEs). Akumulasi AGEs pada tendon dapat menyebabkan mekanisme cross-link dengan kolagen dan aktivasi jalur persinyalan receptor of advanced glycation end products (RAGE) yang menyebabkan struktur kolagen menjadi tidak teratur. Pembuatan model DMT2 dilakukan dengan hewan model tikus dengan metode high fat diet dan induksi streptozotocin (STZ) pada galur tikus Sprague Dawley. Studi pendahuluan yang dilakukan menunjukkan pada dosis STZ 30 mg/Kg tidak menunjukkan hewan model DMT2. Oleh karena itu, tujuan pada penelitian ini adalah untuk melakukan studi histologis achilles tendinopathy yang disebabkan oleh DMT2 pada ketiga dosis (30 mg/Kg, 40 mg/Kg dan 65 mg/Kg) dan dilanjutkan dengan studi ekspresi gen efek gen RAGE. Studi ini menggunakan sampel tendon achilles tikus yang sudah dibuat model DMT2 dengan metode high fat diet dan induksi streptozotocin (STZ) pada galur tikus Sprague Dawley yang telah dibentuk dalam blok parafin. Terdapat tiga kelompok perlakuan diabetes dengan induksi streptozotocin yang berbeda, yakni dosis STZ 30 mg/Kg, 40 mg/Kg, dan 65 mg/Kg. Metode yang digunakan untuk membuat preparat histologis adalah dengan metode parafin dengan dua pewarnaan, yakni hematoksilin dan eosin Harris dan masson trichrome untuk melihat struktur kolagen. Untuk identifikasi ekspresi gen RAGE menggunakan metode quantitative real time polymerase chain reaction. Hasil penelitian menunjukkan bahwa achilles tendinopathy yang disebabkan oleh diabetes memberikan hasil gambaran histologis dengan terjadinya kerusakan jaringan tendon yang ditandai dengan disorganisasi kolagen yang terlihat pada dosis STZ 65 mg/Kg. PaPada dosis STZ 30 mg/Kg dan 40 mg/Kg, kondisi kolagen masih dalam kolagen yang mirip dengan tendon sehat dengan beberapa daerah mulai mengalami disorganisasi kolagen. Ekspresi gen RAGE dengan menggunakan qRT-PCR menghasilkan tingkat ekspresi gen RAGE yang meningkat sebanyak 2,71 kali pada kelompok perlakuan diabetes dibandingkan dengan kelompok normal. Kesimpulan yang didapatkan pada penelitian ini adalah model tikus DMT2 menunjukkan perubahan dan disorganisasi tendon. Pada sampel tikus dosis STZ 65 mg/Kg menghasilkan disorganisasi tendon paling parah dibandingkan dengan dosis injeksi STZ 30 mg/Kg dan 40 mg/Kg. Selain itu, pada tendon perlakuan diabetes didapatkan tingkat ekspresi gen RAGE yang meningkat sebanyak 2,71 kali dibandingkan dengan tendon normal.

---

Achilles tendinopathy is a degenerative condition that can be caused by type 2 diabetes mellitus (DMT2). This disease is caused by the accumulation of advanced glycation end products (AGEs). The buildup of AGEs in the tendon can lead to cross-linking mechanisms with collagen and activation of the receptor for advanced glycation end products (RAGE) signaling pathway, resulting in irregular collagen structure. The disease model was created using a rat model with a high-fat diet and streptozotocin (STZ) induction in Sprague Dawley rats. Preliminary studies showed that the STZ dose of 30 mg/kg did not result in a DMT2 model. Therefore, the aim of this research was to conduct a histological study of Achilles tendinopathy caused by DMT2 at three different doses (30 mg/kg, 40 mg/kg, and 65 mg/kg), followed by studying the gene expression of RAGE-related genes.The study used Achilles tendon samples from rats that were induced with DMT2 using a high-fat diet and STZ induction in Sprague Dawley rats, which were then embedded in paraffin blocks. There were three diabetes treatment groups with different STZ induction doses: 30 mg/kg, 40 mg/kg, and 65 mg/kg. Histological preparations were made using the paraffin method with two staining techniques, namely Harris hematoxylin and eosin staining and Masson trichrome staining to visualize collagen structure. The quantitative real-time polymerase chain reaction (qRT-PCR) method was used to identify RAGE gene expression. The results showed that Achilles tendinopathy caused by diabetes resulted in histological changes in the tendon tissue, characterized by collagen disorganization, particularly evident at the STZ dose of 65 mg/kg. At doses of STZ 30 mg/kg and 40 mg/kg, collagen appeared similar to that of a healthy tendon, but some areas showed signs of collagen disorganization. The qRT-PCR analysis revealed that RAGE gene expression was 2.71 times higher in the diabetes treatment group compared to the normal group.In conclusion, the DMT2 rat model exhibited changes and disorganization in the tendon. The 65 mg/kg STZ injection in rat samples resulted in the most severe tendon disorganization compared to the 30 mg/kg and 40 mg/kg STZ injection doses. Additionally, diabetes treatment of the tendon showed a 2.71-fold increase in RAGE gene expression compared to the normal tendon."