Hasil Pencarian  ::  Simpan CSV :: Kembali

Hasil Pencarian

Ditemukan 36748 dokumen yang sesuai dengan query
cover
Pulungan, Elitha Sundari
"Demam Berdarah Dengue (DBD) adalah infeksi yang disebabkan oleh virus dengue (DENV) yang tersebar luas di wilayah tropis dan subtropis di dunia. DENV merupakan virus RNA rantai tunggal yang mengkode tiga protein struktural, tujuh protein non-struktural, dan dua daerah yang tidak ditranslasikan (UTR). Protein non-struktural 1 (NS1) DENV diketahui memiliki peran yang sangat penting dalam patogenesis infeksi DENV dan sebagai pengembangan vaksin dengue yang menjanjikan. Saat ini, pengembangan vaksin baru dengan DNA yang diimunisasikan memberikan perspektif baru karena aman, stabil, dan imunogenik. Pada penelitian sebelumnya, kami telah berhasil mengonstruksi vaksin rekombinan DNA yang mengkode protein NSI dari DENV-2 (pUNS1) dan diekspresikan secara in-vitro. Oleh karena itu, pada penelitian ini dilakukan analisis lebih lanjut untuk melihat kemampuan pUNS1 dalam menginduksi respons imun humoral dengan imunisasi in-vivo. Sebanyak 16 mencit Balb/c yang berumur 4 minggu diimunisasi sebanyak 3 kali dengan 100 μg pUNS1 atau pUMVC4.a dalam interval waktu 1 minggu. Pengambilan sampel darah mencit dilakukan sebelum imunisasi dan dilakukan terminasi 1 minggu setelah imunisasi terakhir. Titer antibodi dari serum masing-masing mencit diukur dengan ELISA in-house. Titer IgG total, antibodi subkelas IgG2a dan IgG2b dari kelompok mencit yang diimunisasi dengan rekombinan pUNS1 menunjukkan perbedaan yang signifikan antara serum pre-imunisasi dengan terminasi. Hal ini membuktikan kemampuan pUNS1 dalam menginduksi respons imun humoral terhadap NS1 DENV-2 secara in-vivo

Dengue Hemorrhagic Fever (DHF) is an infectious disease caused by the dengue virus (DENV) which spread widely in tropical and subtropical regions of the world. DENV is a single-positive strand RNA virus which encodes three structural proteins, seven non-structural proteins, and two untranslated regions (UTR). The non-structural protein-1 (NS1) of DENV is known to have important role in dengue pathogenesis also promising to be developed as dengue vaccine. Lately, novel vaccine approach by DNA immunization have given new perspective for a safe, stable, and immunogenic vaccine platform. Previously, we have successfully construct DNA vaccine encoding NS1 protein of DENV2 (pUNS1) which express recombinant NS1 protein in-vitro. Thus, in this current study the ability of pUNS1 to induce humoral immune response will be further analyzed by in-vivo immunization. Sixteen Balb/c mice aged of 4 weeks were immunized 3 times with 100 μg of pUNS1 or pUMVC4.a on 1 week time interval. Blood sampling was carried out just before immunization and termination was done 1 week after last immunization. Titer from individual mice sera against DENV-2 were measure with in-house ELISA. Total IgG titers, subclass IgG2a, and IgG2b antibodies from mice group immunized with recombinant pUNS1 showed a significant difference between pre-immunization and terminated serum. This is proven the ability of pUNS1 to induce humoral immune response against NS1 DENV-2 in-vivo."
Depok: Fakultas Kedokteran Universitas Indonesia, 2020
T-Pdf
UI - Tesis Membership  Universitas Indonesia Library
cover
Rina Yunita
"ABSTRAK
Latar Belakang : Penyakit demam dengue dan demam berdarah dengue yang disebabkan oleh virus dengue masih menjadi masalah kesehatan di dunia. Hingga saat ini pengobatan spesifik serta vaksin untuk infeksi dengue belum tersedia, dan berbagai strategi pembuatan vaksin sedang dikembangkan oleh berbagai pihak. Sebagai salah satu negara endemis infeksi dengue, Indonesia juga perlu melakukan pengembangan vaksin dengue dengan menggunakan strain virus yang berasal dari Indonesia. Pada penelitian ini akan dikembangkan kandidat vaksin DNA rekombinan dengan gen insersi Premembran dan Envelope virus dengue tipe 2 sebagai bagian dari pengembangan vaksin dengue tetravalen di Indonesia.
Metode : Plasmid DNA rekombinan dirancang mengandung gen premembran dan envelope dari virus dengue tipe 2 isolat Indonesia. Fragmen DNA diinsersi ke dalam vektor plasmid pUMVC4a serta ditransformasi ke dalam sel E.coli DH5-α. Klon plasmid yang didapat dikonfirmasi dengan metode PCR, enzim restriksi dan sekuensing. Ekspresi protein dari plasmid diuji melalui metode transfeksi pada sel Vero. Selanjutnya plasmid disuntikkan pada mencit jenis Balb/C sebanyak 3 kali dengan interval 3 minggu pada daerah intramuskular. Penyuntikan menggunakan 2 metode : suntikan intramuskular dengan jarum (IM) dan suntikan dengan menggunakan alat needle-free injector (NFI) dengan menggunakan 2 macam dosis plasmid, yaitu 25 μg dan 100 μg DNA. Pemeriksaan antibodi dilakukan dengan metode ELISA dan PRNT. Setelah fase imunisasi selesai, dilakukan uji tantang dengan menyuntikkan 2,5 x 105 PFU/ml DENV-2 secara intraperitoneal pada beberapa kelompok mencit untuk melihat pembentukan sel B memori. Data antibodi yang diperoleh dianalisis secara deskriptif dan analitik.
Hasil : Plasmid rekombinan pUMD2 telah berhasil diperoleh. Transfeksi pada sel Vero menunjukkan adanya ekspresi protein intra dan ekstraselular melalui pemeriksaan imunostaining dan ELISA. Melalui pemeriksaan ELISA, antibodi terdeteksi hanya pada kelompok penyuntikan NFI (p<0,005). Titer antibodi tertinggi dijumpai pada kelompok penyuntikan dengan NFI dosis 100 μg , kemudian NFI 25 μg dengan perbedaan yang tidak bermakna (p>0,005) antara kedua kelompok tersebut. Melalui PRNT 70% ditemukan bahwa antibodi netralisasi terhadap DENV-2 terbentuk pada mencit yang diberi imunisasi dengan metode NFI, sedangkan pada kelompok IM titernya tidak terdeteksi (<1/10). Titer antibodi terbaik diperoleh pada kelompok penyuntikan NFI dosis 100 ug yaitu 1/80-1/160. Titer hari ke-4 dan 8 setelah penyuntikan 2,5 x 105 PFU/ml virus pada kelompok yang diimunisasi secara IM dan NFI mengalami peningkatan. Sebaliknya, pada kelompok yang tidak diberi virus tidak terdapat peningkatan titer netralisasi. Hal ini menunjukkan adanya pembentukan sel B memori dari imunisasi yang diberikan.
Kesimpulan : Pembuatan plasmid rekombinan dengan gen insersi pre-M dan E DENV2 strain DS18/09 telah berhasil dilakukan. Terdapat respon antibodi netralisasi dan anamnestik dari mencit yang diberi imunisasi secara NFI, namun imunisasi secara IM hanya menunjukkan respon antibodi anamnestik dari sel memori. Plasmid DNA rekombinan ini memiliki potensi sebagai kandidat vaksin DNA terhadap virus dengue tipe 2. Perlu dilakukan penelitian selanjutnya berupa rancangan vaksin tetravalen dalam upaya pengembangan vaksin dengue secara menyeluruh.

ABSTRACT
Introduction : Dengue fever and dengue haemorrhagic fever caused by dengue virus is still a major health problem. There are four types of Dengue virus which antigenically distinguished : DEN-1, DEN-2, DEN-3, DEN-4. Currently, no specific treatment for Dengue infection and no vaccine are available, and various strategies have been used to develop dengue vaccine. Indonesia as one of dengue-endemic country has to attempt dengue vaccine development particularly using Indonesian virus strain. In this study, recombinant DNA vaccine candidate using DENV-2 pre-membrane and envelope genes was constructed as a part of dengue tetravalent vaccine development in Indonesia.
Methods : The recombinant plasmid consisting pre-membrane and envelope genes from DENV-2 Indonsia isolate was constructed. DNA fragment were inserted to pUMVC4a plasmid vector and then transformed to E. Coli DH5-α. The construction was confirmed using PCR, restriction enzyme and sequencing. Protein expressions of preM and E were determined by transfection into Vero cells. Group of Balb/C mice were injected with amount of plasmid via intra muscular route. The injection was conducted using 2 delivery methods : conventional syringe-needle (IM) and needle-free injector (NFI) device. Doses of plasmid that being compared are 25 μg and 100 μg. Mice were immunized with plasmid 3 times with 3 weeks interval. Antibody titre were determined by ELISA and PRNT. After immunization phase, part group of mice challanged with 2,5 x 105 PFU/ml DENV-2 intra peritoneally to confirm wether immunization induced memory cells. Antibody data were interpretated by descriptive and analytic methods
Results : The recombinant plasmid pUMD2 has been constructed. Confirmation of gene secuence showed no mutation at the clone. Vero cells-81 transfected with pUMD2 expressed prM and E as determined by immunofluorescence staining as intracellular protein and by ELISA to detect extracellular protein. In ELISA results, antibody was detected only in NFI group (p<0,005). Highest antibody titre was found in NFI group with dose 100 μg followed by dose 25 μg. However, antibody titre by ELISA between NFI group dose 100 μg and 25 μg were not statistically significant (p>0,005). Neutralizing antibody by PRNT 70% showed concordant result compared to ELISA. Neutralizing titre to DENV-2 was developed in NFI group, but it was not detectable in IM group of mice (<1/10). The highest titre of neutralization achieved by 100 μg, NFI group whose titer 1/80-1/160. Immunized mice in all groups raised greater neutralizing antibody titers on days 4 and 8 after challange with 2,5 x 105 PFU/ml of DS 18/09 of dengue type 2 virus. Compared to immunized mice that were not challanged which developed no increasing neutralizing titre, it indicated that immunization could produced memory B cell responses.
Conclusions : Recombinant plasmid as a candidate for dengue DNA vaccine has been constructed. The plasmid expressed premembrane and envelope proteins in Vero cells. Immunogenicity test from the plasmid DNA demonstrated neutralizing antibody responses and anamnestic responses in mice which immunized only by NFI method. IM injection method only showed anamnestic antibody responses. Overall, this DNA plasmid has a potency to be used as a candidate for DNA vacine against dengue virus type-2. Study for designing tetravalent vaccine model is necessary as a part in vaccine dengue development."
2012
T-Pdf
UI - Tesis Membership  Universitas Indonesia Library
cover
Lola Febriana Dewi
"ABSTRAK
Infeksi yang disebabkan oleh virus dengue telah banyak dilaporkan di negara tropis dan subtropis. Virus dengue terdiri dari 4 serotipe yaitu dengue 1-4. Hingga saat ini belum tersedia vaksin yang berlisensi untuk mencegah terjadinya infeksi dengue. Pada penelitian ini dikonstruksi vaksin DNA yang mengkode gen prM-E dan prM-E-NS1del virus dengue 2 strain Indonesia yang akan dijadikan sebagai kandidat vaksin dengue. Hasil penelitian berhasil mendapatkan 9 plasmid rekombinan pUMDE2 yang membawa gen sisipan prM-E dan telah dikonfirmasi dengan melakukan PCR koloni dan restriksi plasmid. Dari hasil sekuensing plasmid pUMDE2 koloni no. 11 ditemukan 19 mutasi asam amino pada gen prM-E, sepuluh mutasi pada gen prM dan sembilan mutasi pada gen E. Mutasi protein prM N29D dan N52K serta protein E V164I dan S390N terletak pada daerah epitop pengenalan sel B. Transfeksi plasmid pUMDE2 dilakukan pada sel Chinese Hamster Ovary (CHO)-K1 dan menunjukkan adanya ekspresi protein prM-E rekombinan berdasarkan uji imunostaining dan ELISA. Hasil ELISA menunjukkan bahwa protein ditemukan pada sel yang ditransfeksi. Sedangkan, plasmid rekombinan yang membawa gen prM-E-NS1del tidak berhasil dikonstruksi. Plasmid pUMDE2 dapat dikembangkan menjadi kandidat vaksin DNA.

ABSTRACT
Infection by dengue virus were reported in tropical and subtropical area. Dengue virus (DENV) consist of 4 serotype, DENV-1 to DENV-4. There is no licensed vaccine available for dengue infection. In this research, we construct DNA vaccine encode prM-E and prM-E-NS1del genes of dengue virus serotype 2 for vaccine development. Nine recombinant plasmids that encode prM-E genes (pUMDE2), were successfully obtained. Recombinant plasmids were confirmed by PCR colony and restriction enzyme analysis. Colony of pUMDE2 no. 11 was sequenced and total 19 amino acid mutations were founds, 10 mutations in prM and 9 mutations in E protein. prM mutations N29D and N52K, E mutations of V164I and S390N were found in B cell epitopes. Transfection pUMDE2 plasmid was done to Chineese Hamster Ovary (CHO)-K1 and showed that recombinant protein prM-E was successfully expressed by immunostaining assay and ELISA. Results showed that the protein was mainly found in cell fraction. However, recombinant plasmid that encode prM-E-NS1del were failed to be constructed. pUMDE2 could be developed for vaccine candidate.
"
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2016
T-Pdf
UI - Tesis Membership  Universitas Indonesia Library
cover
Nur Ashrina Syafrizal
"ABSTRAK
Virus dengue DENV dapat menginfeksi manusia tanpa batasan usia di daerah tropis dan subtropis. Vaksin DENV dari keempat serotype sangat diperlukan untuk mencegah infeksi DENV. Tujuan dari penelitian ini untuk melihat respon imun seluler CD4, CD8, dan CD25 pada mencit yang diimunisasi dengan vaksin DNA pUMD4 kla/b. Plasmid pUMD4 kla/b diproduksi dan diisolasi dengan menggunakan berbagai metode. Uji ekspresi pUMD4 kla/b dilakukan dengan transfeksi pada sel Chinese Hamster Ovary. Plasmid yang telah mengekspresikan protein preM-E DENV-4 selanjutnya diimunisasikan pada mencit ddY pada hari ke-0, ke-21, dan ke-42. Hasil analisis limpa tanpa induksi dengan menggunakan uji flow cytometry menunjukkan persentase CD4 pada mencit yang diimunisasi lebih rendah jika dibandingkan dengan kelompok pUMVC4a dan kelompok tanpa imunisasi. Akan tetapi persentase CD8 dan CD25 menunjukkan hasil yang lebih tinggi jika dibandingkan dengan kelompok pUMVC4a dan kelompok tanpa imunisasi. Analisis limpa dengan induksi pada mencit yang diimunisasi sebesar 3,7 CD4 , 9,7 CD8 , dan 13 CD25 secara berurutan dan persentase CD4, CD8, dan CD25 lebih tinggi jika dibandingkan dengan kelompok pUMVC4a dan kelompok tanpa imunisasi setelah imunisasi ke-3. Kesimpulan penelitian ini adalah adanya aktivasi imun seluler pada mencit setelah imunisasi dengan pUMD4 kla/b.

ABSTRACT
Dengue virus infected humans in every ranges of ages at tropical and subtropical regions. In previous study DNA vaccine pUMD4 kla b was constructed. The purpose of this research is to inform cellular immune responses CD4, CD8, and CD25 in mice those were immunised by pUMD4 kla b. pUMD4 kla b plasmid was isolated by many methods. Expression test of pUMD4 kla b was held by transfection on CHO cells. pUMD4 kla b that had expressed preM E dengue proteins was immunised in ddY mice in aged 5 6 weeks on day 0, day 21, and day 42. Evaluation of immunizations could be seen from flow cytometry test on mice rsquo s splenocytes. pUMD4 kla b could express preM E dengue proteins. Result showed enhancements on percentages rsquo numbers of CD4 cells 2.6 , CD8 cells 4.4 , and CD25 6 in ddY mice without induction, and CD4 cells 3.7 , CD8 cells 9.7 , and CD25 13 with induction after third immunizations. Percentages of CD4, CD8, and CD25 in pUMD4 kla b rsquo s immunizations are higher than in pUMVC4a rsquo s immunizations and without immunizations. Conclusion there were cellular immunity activations after immunized with pUMD4 kla b."
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2018
T58957
UI - Tesis Membership  Universitas Indonesia Library
cover
Aulia Tresna Amalia Ilmi
"Infeksi human papillomavirus tipe 16 (HPV16) dapat menyebabkan kanker servikk, penyebab kematian no 2 di dunia. Salah satu pencegahannya adalah dengan imunisasi. Vaksin komersil saat ini merupakan vaksin viral like particles (VLP) diproduksi pada sistem ekspresi yeast dan baculovirus. Sebagai upaya penyediaan vaksin dengan harga lebih ekonomis telah dilakukan pengembangan vaksin DNA dan protein rekombinan L1 HPV16 yang diekspresikan di prokariota. Antigenitas vaksin DNA dan L1 rekombinan diujikan dalam peneltian ini. Penelitian dimulai dari pemindahan L1 dari pUC L1 HPV16 ke pCDNA3.1, ekspresi L1 rekombinan dalam prokariota, pengamatan pembentukan VLP oleh L1 rekombinan dengan transmission electron microscope (TEM), pengujian antigenitas kombinasi vaksin DNA dan protein rekombinan pada BALB/c. Hasil menunjukkan pcDNA3.1 L1 berhasil diperoleh yang dibuktikan dengan analisis enzim restriksi dan sekuensing. L1 rekombinan berhasil membentuk VLP, vaksin komposisi 12,5 μg pcDNA3.1 L1 dikombinasikan 2 μg L1 rekombinan menginduksi titer antibodi endpoint tertinggi pada pengambilan serum terakhir yaitu 23.55 (p<0.05) dibandingkan vaksin 12,5 μg pcDNA3.1 L1 (2.775) dan 2 μg L1 rekombinan (10.45) yang diberikan secara terpisah setelah 3 kali imunisasi. Sebagai kesimpulan pCDNA3.1L1 berhasil diperoleh, protein L1 rekombinan dapat membentuk VLP dan pemberian kombinasi pcDNA3.1 L1 dan L1 rekombinan menginduksi respon kekebalan tubuh lebih bagus dibandingkan pemberian secara terpisah.

Infection with human papillomavirus type 16 (HPV16) can cause cervical cancer, the second cause of death in the world. One way to prevent it is with a barrier. The current commercial vaccine is a viral like particle (VLP) vaccine produced on yeast and baculovirus expression systems. As an effort to provide a vaccine at a more economical price, a DNA vaccine and a recombinant L1 HPV16 protein that are expressed in prokaryotes have been developed. The antigenicity of recombinant DNA and L1 vaccines was tested in this study. The research started with the transfer of L1 from pUC L1 HPV16 to pCDNA3.1, expression of recombinant L1 in prokaryotes, assessment of VLP formation by recombinant L1 with transmission electron microscopy (TEM), testing the antigenicity of a combination of DNA vaccines and recombinant protein on BALB/c. The results showed that pcDNA3.1 L1 was successfully obtained, as evidenced by restriction enzyme analysis and sequencing. The recombinant L1 succeeded in forming a VLP, the composition of the vaccine 12.5 µg PCDNA3.1 L1 combined 2 µg L1 recombinant induced the highest endpoint antibody titer (10.45) which was given 23.55 (p <0.05) compared to the 12.5 µg vaccine PCDNA 3.1 L1 (2,775) and 2 µg L1 recombinant (10.45) given by 3 times. As a conclusion, pCDNA3.1L1 was successfully obtained, recombinant L1 protein can form VLP and provide a combination of recombinant pcDNA3.1 L1 and L1 induce an immune response better than administration separately."
Depok: Fakultas Kedokteran Universitas Indonesia, 2023
T-pdf
UI - Tesis Membership  Universitas Indonesia Library
cover
Fitri Rahmi Fadhilah
"Penelitian mengenai pengembangan vaksin DNA pengekspresi antigen fusi hemaglutinin dan VP22 terhadap respon antibodi spesifik dan sel T CD8 pada mencit BALB/c telah dilakukan. Tujuan penelitian ini adalah untuk menilai penambahan VP22 secara terfusi pada plasmid pcDNA H5cop?TM terhadap respon imun humoral dan seluler yang diinduksi oleh vaksin DNA pemgekspresi antigen hemaglutinin virus influenza A H5N1.
Metodologi yang digunakan dalam penelitian ini yaitu uji eksperimental berupa kenaikan dan reaktivitas serum yang diperoleh dari kelompok mencit BALB/c yang divaksin dengan pcdnawt, pcdna-H5cop?TM, pcdna-, pcdnaH5cop?TM-VP22, pcdnaH5copfull serta respon sel T CD8 dari spleen mencit BALB/c yang mensekresikan IFN-? spesifik terhadap peptida H5N1 MHC Class I. Mencit BALB/c berusia 8 minggu divaksinasi sebanyak tiga kali secara intramuskular dengan interval waktu 2 minggu untuk tiap vaksinasi. Semua kelompok mencit menunjukkan peningkatan respon antibodi spesifik dibandingkan dengan kontrol dengan nilai rasio OD serum ketiga pada kelompok mencit pcdna-H5cop?TM, pcdnaH5cop?TM-VP22, pcdnaH5copfull dan kontrol secara berurutan adalah 1.71 p=0.006 , 1.56 p=0.010 , 1,05 p=0.016 dan 1.01.
Hasil uji statistik menunjukkan bahwa tidak ada perbedaan bermakna pada kelompok perlakuan pcdna-H5cop?TM dengan pcdnaH5cop?TM-VP22 terhadap protein HA p=0.200 . Sementara pada respon sel T CD8 yang diperoleh dari optimasi ELISPOT menunjukkan adanya spot forming unit SFC pada spleen mencit yang divaksinasi dengan pcdnaH5cop?TM-VP22 pada berbagai konsentrasi peptida H5N1 yaitu berturut-turut 20 spot 100ng , 22 spot 250ng , 22 spot 500ng , 49 spot 750ng , dan 72 spot 1000ng . Nilai spot tertinggi didapatkan dengan konsentrasi peptida H5N1 sebanyak 1000ng. Hasil yang diperoleh mengindikasikan bahwa dengan adanya penambahan VP22 secara terfusi pada pcdna-H5cop?TM dapat meningkatkan respon seluler terhadap virus influenza A H5N1.

Research on the development of DNA vaccines expressing a fused gene of haemagglutinin HA and VP22 towards specific antibody and CD8 T cells responses in mice BALB c has been done. The purpose of this study was to asses the fused VP22 into the pcDNA H5cop TM towards humoral and cellular imune responses.
The methodology used in this study was experimental method that focused on increase of antibody level of serum obtained from groups of BALB c mice that previously vaccinated with pcDNAwt, pcDNA H5COP TM, pcDNA, pcDNA H5COP TM VP22, pcDNA H5COP full. Response CD8 T cell generated from spleen of mice BALB c that secreted IFN H5N1 peptides specific to MHC class I was also observed. Significant increase of level of specific antibody response were shown by value of control compared to third serum with mean value of OD optical density of pcDNA H5COP TM, pcDNA H5COP TM VP22, pcDNA H5COP full and control 1.71 p 0.006 , 1.56 p 0.010 , 1,05 p 0.015 and 1,01 respectively. Statistical analysis showed that there was no significant difference in group treated with pcDNA H5COP TM with pcDNA H5COP TM VP22 towards HA protein p 0.200.
The ELISPOT optimizations showed response to CD8 T cells by formation of spot forming units SFC in the spleen of mice vaccinated with pcDNA H5COP TM VP22 with various concentrations of peptide H5N1 applied, 20 spots 100ng , 22 spots 250ng , 22 spots 500ng , 49 spots 750ng , and 72 spots 1000ng respectively. The highest value obtained by peptide of H5N1 with a total peptide 1000ng. The results indicated that the fused of VP22 into the pcDNA H5cop TM can enhance cellular responses against H5N1 influenza A virus.
"
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2017
T55639
UI - Tesis Membership  Universitas Indonesia Library
cover
Siti Rayhani Fadhila
"Demam berdarah merupakan salah satu masalah kesehatan di dunia. Infeksi virus dengue yang berulang dengan serotipe yang berbeda dapat memacu terjadinya demam berdarah bahkan kematian. Dengue serotipe 4 dilaporkan dapat menyebabkan infeksi sekunder yang lebih parah dibandingkan dengue serotipe lainnya. Sampai saat ini pengobatan demam berdarah belum ditemukan, maka itu pencegahan jauh lebih penting.
Para peneliti telah merekomendasikan vaksin aman berbasis nonstructural protein 1 (NS1) karena sifat imunogeniknya. Mereka telah mengidentifikasi empat epitope di NS1 yang diduga bereaksi kuat dengan epitope B cells, yaitu LD2, 24A, LX1, 24C. Tujuan dari riset ini adalah untuk menganalisa dan membandingkan strain DENV-4 yang diisolasi di Jakarta 2010 dengan 34 strain DENV-4 lainnya yang didapat dari GenBank menggunakan UGENE software sebagai basis dari pengembangan vaksin. Penelitian ini menggunakan data sekunder berupa urutan nukelotida virus dengue serotipe 4 strain IDSS44/10 yang diamplifikasi dan diurutkan di Departemen Mikrobiologi, FKUI.
Dari hasil penelitian ini dapat disimpulkan bahwa gen NS1 dari DENV-4 strain IDSS44/10 dapat digunakan sebagai kandidat vaksin dengue di masa mendatang. Hasil menunjukkan bahwa epitope 24C menunjukkan motif yang homolog di setiap sekuens asam amino pada NS1 DENV-4. Hampir seluruh DENV-4 strain yang diisolasi termasuk IDSS44/2010 memiliki urutan asam amino yang sama pada epitop LD2, 24A, LX1, 24C.

Dengue hemorrhagic fever has become a worldwide issue. Heterologous infection by different serotypes may lead to this advanced stage of dengue infection and even death. Dengue virus serotype 4 has been reported to cause more severe secondary infection compared to other serotypes. To date, there is no specific treatment for this disease therefore prevention is much more important.
Researchers have proposed a safe vaccine strategy that is based on nonstructural protein 1 (NS1) as it is strongly immunogenic. They identified four epitopes on NS1 that reacted strongly to B cell epitopes which are LD2, 24A, LX1, and 24C. The goal of this research is to identify and compare these NS1 epitopes among DENV-4isolated in Indonesia 2010 with other DENV-4 strains using UGENE softwareas a base of vaccine development. This study used a nucleotide sequence data of DENV-4 strain IDSS44/10 that was amplified and sequenced in Microbiology Department, FKUI.
The results show that NS1 gene DENV-4, IDSS44/2010 strain could be used as a dengue vaccine candidate in the future.The results show that 24C epitope was highly conserved among 35 DENV-4 NS1 sequences. Most of the DENV-4 including IDSS44/10 Indonesian strain have similar amino acids sequences on the epitopes (LD2, 24A, LX1, and 24C).
"
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2013
S-Pdf
UI - Skripsi Membership  Universitas Indonesia Library
cover
Khansa Humaira
"Demam berdarah dengue (DBD) merupakan penyakit yang disebabkan oleh infeksi virus dengue (DENV) dan masih menjadi endemi di negara-negara tropis dan subtropis. Salah satu bentuk pencegahan infeksi DENV adalah vaksinasi. Salah satu platform vaksin DENV yang dikembangkan adalah vaksin inaktif. Penelitian ini menggunakan empat metode inaktivasi DENV, yaitu formaldehid, psoralen 4′-Aminomethyltrioxsalen hydrochloride (AMT), UV dan pemanasan. Virus yang sudah diinaktivasi diuji antigenisitas, viabilitas, dan imunogenisitas menggunakan ELISA, focus assay, dan mencit Balb/C, secara berurutan. Imunisasi mencit dilakukan dengan menyuntikkan 10μg protein dalam 50μl per mencit. Titer antibodi IgG dan antibodi netralisasi pasca imunisasi dianalisa menggunakan ELISA dan focus reduction neutralization assay (FRNT). Hasil uji imunogenisitas menggunakan ELISA, menunjukkan kenaikan titer antibodi pada mencit yang divaksinasi. Vaksin inaktif dengan formaldehid menginduksi titer antibodi tertinggi. Sedangkan, hasil uji imunogenisitas dengan FRNT, virus yang diinaktivasi dengan formaldehid dan AMT, menghasilkan titer antibodi netralisasi yang lebih tinggi dibandingkan dengan virus yang diinaktivasi dengan metode lainnya. Titer FRNT50 dan FRNT90 pada vaksin yang diinaktivasi dengan formaldehid dan AMT memiliki titer yang sama, yaitu 1/80 dan 1/10. Hasil tersebut menunjukkan bahwa inaktivasi virus dengan formaldehid dan AMT berpotensi untuk dikembangkan menjadi kandidat vaksin DENV di masa mendatang.

Dengue hemorrhagic fever (DHF) is a disease caused by dengue virus (DENV) infection and is still endemic in tropical and subtropical countries. One form of prevention of DENV infection is vaccination. One of the DENV vaccine platforms developed is an inactivated vaccine. This study used four DENV inactivation methods, namely formaldehyde, psoralen 4′-Aminomethyltrioxsalen hydrochloride (AMT), UV and heating. The inactivated virus was tested for antigenicity, viability, and immunogenicity using ELISA, focus assay, and Balb/C mice, respectively. Immunization of mice was performed by injecting 10μg of protein in 50μl per mice. IgG antibody titers and neutralization antibodies after immunization were analyzed using ELISA and focus reduction neutralization assay (FRNT). Immunogenicity test results using ELISA showed an increase in antibody titer in vaccinated mice. Formaldehyde inactivation vaccine induced the highest antibody titer. Meanwhile, the results of immunogenicity tests with FRNT, viruses inactivated with formaldehyde and AMT, produced higher neutralization antibody titers compared to viruses inactivated by other methods. The titer of FRNT50 and FRNT90 in vaccines inactivated with formaldehyde and AMT had the same titer, namely 1/80 and 1/10. These results indicate that virus inactivation with formaldehyde and AMT has the potential to be developed into DENV vaccine candidates in the future."
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2022
T-pdf
UI - Tesis Membership  Universitas Indonesia Library
cover
Marsandi Nugraprawira Mardjoeki
"Demam berdarah merupakan sebuah masalah kesehatan besar yang mengancam banyak negara tropis, termasuk Indonesia. Beberapa tahun terakhir penyakit ini berkembang menjadi semakin parah. Hal ini diperparah dengan tidak adanya antivirus maupun Vaksin untuk infeksi dengue. Penelitian ini bertujuan untuk melakukan desain primer untuk amplifikasi gen Non Structural -3 (NS-3) serotype 2 (DENV-2) strain Indonesia (AB189124) yang bisa disisipkan pada plasmid pPICZ-alphaA dan diekspresikan pada vektor Pichia pastoris. Hasil penelitian didapatkan pasangan primer yang dapat digunakan untuk membuat protein rekombinan NS-3 DENV-2. Pasangan primer tersebut adalah pasangan CGC + KpnI + Primer (4468) = CGC + GGTACC + TCCCGTGTCAATACCAATCA dan SacII + Primer (6495) = CCGCGG + AGCATGATTGTACGCCCTTC. Dengan mempertimbangkan sekuens keseluruhan gen NS-3 DENV-2, epitope, dan enzim restriksi pada plasmid dan NS-3, maka pasangan primer tersebut dapat digunakan untuk membuat protein rekombinan NS-3 DENV-2 sebagai kandidat Vaksin dengue.

Dengue Fever is a major health problem which threatens a lot of tropical countries, including Indonesia. In the last few years, this epidemic grew worse. This was aggravated by the nonexistence of neither vaccine nor antivirus capable of neutralizing dengue virus serotype 1-4. This research focused on designing primer for amplification of Non Structural-3 (NS-3) dengue virus serotype 2 (DENV-2) Indonesian strain (AB189124) which could be spliced into pPICZ-alhpaA and expressed on Pichia pastoris vector. Research result was a primer pair which could be used to produce NS-3 DENV-2 recombinant protein. These primer pair were CGC + KpnI + Primer (4468) = CGC + GGTACC + TCCCGTGTCAATACCAATCA dan SacII + Primer (6495) = CCGCGG + AGCATGATTGTACGCCCTTC. By considering overall sequence of NS-3 DENV-2 genes, epitope, and restriction enzyme on plasmid and NS-3, these primer pair could be use to produce NS-3 DENV-2 recombinant protein as a dengue vaccine candidate."
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2012
S-Pdf
UI - Skripsi Membership  Universitas Indonesia Library
cover
Lenggo Geni
"[ABSTRAK
Demam berdarah dengue (DBD) merupakan penyakit yang disebabkan karena
infeksi virus dengue (DENV), yang banyak ditemukan di Indonesia. Belum ada
terapi yang spesifik dalam pengobatan DBD. Upaya pengembangan vaksin
dengue yang efektif sangat diperlukan. Pada penelitian ini dilakukan analisa
imunogenisitas kandidat vaksin DNA prM-E dengue serotipe 2 (pUMD2.kl.20)
dengan menganalisis sel T CD4, sel T CD8, IFN-γ dan TNF-α. pada sel U937 dan
PBMC secara in vitro, bertujuan untuk mengetahui respon imun ketika vaksin
diinjeksikan ke dalam tubuh manusia. Dasar penelitian ini adalah sel U937
ditransfeksi dengan pUMD2.kl.20 menggunakan lipofectamin. Sel U937 akan
berperan sebagai APCs yang akan mengekspresikan protein prM-E DENV-2 dan
mempresentasikan protein tersebut melalui molekul MHC class I dan MHC class
II kepada Peripheral Blood Mononuclear Cell (PBMC) manusia. Tahapan kerja
yang dilakukan dalam penelitian ini terdiri dari: (a) kultur galur sel U937, (b)
transfeksi sel U937 dengan pUMD2.kl.20, (c) transfeksi sel U937 dengan plasmid
s(pUMVC), (d) infeksi sel U937 dengan DENV-2 strain DS.18/09, (e) pewarnaan
dan pengamatan hasil pewarnaan menggunakan alat semi flowcytometri (TALI).
pUMD2.kl.20 mengaktivasi sel T CD4 dan sel T CD8 untuk berploriferasi. Hasil
penelitian ini menunjukkan bahwa konsentrasi sel T CD8 lebih tinggi dari
konsentrasi sel T CD4 dan konsentrasi sel positif yang mensekresikan IFNγ lebih
tinggi dari konsentrasi sel positif yang mensekresikan TNFα. Kondisi optimal dari
aktivasi sel T CD4 oleh pUMD2.kl.20 adalah 24 jam setelah penambahan PBMC
setelah transfeksi (8,53x10⁴sel/ml), untuk sel T CD8 adalah 24 jam setelah
penambahan PBMC setelah transfeksi (49,4x10⁴ sel/ml). Kondisi optimal dari
aktivasi sel+ yang mensekresikan IFNγ oleh pUMD2.kl.20 adalah 24 jam setelah
penambahan PBMC 48 jam setelah transfeksi (9,86x10⁴ sel/ml), dan untuk sel+
yang mensekresikan TNFα adalah 2 jam setelah penambahan PBMC 48 jam
setelah transfeksi (2,1x10⁴ sel/ml). Dari penelitian ini dapat disimpulkan bahwa
pUMD2.kl.20 bersifat imunogenik.

ABSTRACT
Dengue hemorrhagic fever (DHF) is a disease caused by infection with dengue
virus (DENV), which is found in Indonesia. There is no specific therapy in the
treatment of DHF. An effort to develop an effective dengue vaccine is needed. In
this research, analysis of the immunogenicity of the DNA vaccine candidate prME
dengue serotype 2 (pUMD2.kl.20) by analyzing the CD4 T cells, CD8 T cells,
IFN-γ and TNF-α in U937 cells and PBMC in vitro, aims to determine the
immune response when the vaccine is injected into the human body. This research
approach is based on transfection of U937 cells with pUMD2.kl.20 using
lipofectamin. U937 cells acts as APCs which will express the protein prM-E
DENV-2 and presenting these proteins through the MHC class I and MHC class II
molecule to the Peripheral Blood Mononuclear Cell (PBMC) of human body.
Stages of the work in this study consisted of: (a) culture cell line U937, (b)
transfection of U937 cells with pUMD2.kl.20, (c) transfection of U937 cells with
plasmid (pUMVC), (d) infection of U937 cells with DENV-2 strains DS.18/09,
(e) staining and observation results of staining using a semi-flow cytometri
(TALI). pUMD2.kl.20 activate CD4 T cells and CD8 T cells to proliferate. CD8 T
cells concentration higher than the concentration of CD4 T cells and the secretion
of INFγ-positive cells concentration higher than the concentration of the secretion
of TNFα-positive cells. Optimal condition of CD4 T cells activation by
pUMD2.kl.20 is 24 hours after the addition of PBMC after transfection (8,53x10⁴
cells/ml), for CD8 T cells was 24 hours after the addition of PBMC after
transfection (49,4x10⁴ cells/ml). Optimal conditions secretion of IFNγ-positive
cells were activated by pUMD2.kl.20 is 24 hours after the addition of PBMC 48
hours after transfection (9,86x10⁴ cells/ml), and for the secretion of TNFα-
positive cells were activated by pUMD2.kl.20 is 2 hours after the addition of
PBMC 48 hours after transfection (2,1x10⁴ cells/ml). From this study it can be
concluded that the pUMD2.kl.20 immunogenic, Dengue hemorrhagic fever (DHF) is a disease caused by infection with dengue
virus (DENV), which is found in Indonesia. There is no specific therapy in the
treatment of DHF. An effort to develop an effective dengue vaccine is needed. In
this research, analysis of the immunogenicity of the DNA vaccine candidate prME
dengue serotype 2 (pUMD2.kl.20) by analyzing the CD4 T cells, CD8 T cells,
IFN-γ and TNF-α in U937 cells and PBMC in vitro, aims to determine the
immune response when the vaccine is injected into the human body. This research
approach is based on transfection of U937 cells with pUMD2.kl.20 using
lipofectamin. U937 cells acts as APCs which will express the protein prM-E
DENV-2 and presenting these proteins through the MHC class I and MHC class II
molecule to the Peripheral Blood Mononuclear Cell (PBMC) of human body.
Stages of the work in this study consisted of: (a) culture cell line U937, (b)
transfection of U937 cells with pUMD2.kl.20, (c) transfection of U937 cells with
plasmid (pUMVC), (d) infection of U937 cells with DENV-2 strains DS.18/09,
(e) staining and observation results of staining using a semi-flow cytometri
(TALI). pUMD2.kl.20 activate CD4 T cells and CD8 T cells to proliferate. CD8 T
cells concentration higher than the concentration of CD4 T cells and the secretion
of INFγ-positive cells concentration higher than the concentration of the secretion
of TNFα-positive cells. Optimal condition of CD4 T cells activation by
pUMD2.kl.20 is 24 hours after the addition of PBMC after transfection (8,53x10⁴
cells/ml), for CD8 T cells was 24 hours after the addition of PBMC after
transfection (49,4x10⁴ cells/ml). Optimal conditions secretion of IFNγ-positive
cells were activated by pUMD2.kl.20 is 24 hours after the addition of PBMC 48
hours after transfection (9,86x10⁴ cells/ml), and for the secretion of TNFα-
positive cells were activated by pUMD2.kl.20 is 2 hours after the addition of
PBMC 48 hours after transfection (2,1x10⁴ cells/ml). From this study it can be
concluded that the pUMD2.kl.20 immunogenic]"
2015
T-Pdf
UI - Tesis Membership  Universitas Indonesia Library
<<   1 2 3 4 5 6 7 8 9 10   >>