Hasil Pencarian  ::  Simpan CSV :: Kembali

Hasil Pencarian

Ditemukan 87199 dokumen yang sesuai dengan query
cover
Leonardus Wibowo Hidayat
"ABSTRAK
Penelitian terkait karakteristik genetik sekuens virus dengue (DENV) diperlukan dalam menilai kekerabatan antara strain DENV yang tersebar di seluruh dunia. Tujuan dalam penelitian ini adalah membandingkan karakteristik genotype dan sekuens data DENV serotipe 2 (DENV-2) nukleotida envelope dibandingkan dengan sekuens data DENV-2 nukleotida Non-Struktural 1 (NS1). Data didapatkan dari Laboratorium Mikrobiologi Fakultas Kedokteran Universitas Indonesia untuk strain data yang berasal dari Indonesia dan GenBank untuk strain data yang berasal dari seluruh dunia sebagai data pembanding dengan jumlah sebanyak 42 data, yang kemudian dianalisis menggunakan Genetyx 5.1. Hasil penelitian didapatkan bahwa sekuens data NS1 strain DENV-2 yang berasal dari Indonesia termasuk ke dalam kelompok genotype Cosmopolitan, serupa dengan hasil analisis data dengan sekuens data envelope strain DENV-2. Sementara pada analisis epitope LX1 yang merupakan epitope khas dari NS1, terdapat berbagai peubahan komponen asam amino pada epitope tersebut dibandingkan dengan sekuens data strain Indonesia yang tergabung ke dalam kelompok genotype Cosmopolitan. Kesimpulan dari penelitian ini adalah bahwa filogenetik dengan menggunakan NS1 sebagai bahan analisis dapat digunakan untuk menentukan genotipe. Sehingga gen NS1 pada DENV-2 strain Indonesia masih dapat dipertimbangkan sebagai salah satu dasar metode pengembangan vaksin.

ABSTRACT
Studies about genetic characteristic between dengue virus serotype 2 (DENV-2) sequence data is needed to determine its relationship between DENV strain over the world. The main purpose of this study is to compare between characteristic of sequence data DENV-2 envelope nucleotide and sequence data DENV-2 Non- Structural 1 (NS1) nucleotide, and analyze between amino acid homology in this study and related previous studies. 42 data used for this study are obtained from Laboratory of Microbiology Faculty of Medicine University of Indonesia for data from Indonesia and form GenBank for data from other countries as a comparison, which is analyzed with software Genetyx 5.1. NS1 sequence data from DENV-2 strain from Indonesia is classified in Cosmpolitan genotype group, which are similar than data analysis from envelope sequence data from same data. Meanwhile in analysis of LX1 epitope, which is considered as typical epitope from NS1, there are any differences in amino acid component at it compared than strain Indonesia data sequences which are included in Cosmopolitan genotype group. As a conclusion, phylogenetic analysis of NS1 nucleotide is useful for determining the genotypes, which means NS1 DENV-2 gene strain Indonesia can be useful as the basis for vaccine development"
2015
S-Pdf
UI - Skripsi Membership  Universitas Indonesia Library
cover
Marsandi Nugraprawira Mardjoeki
"Demam berdarah merupakan sebuah masalah kesehatan besar yang mengancam banyak negara tropis, termasuk Indonesia. Beberapa tahun terakhir penyakit ini berkembang menjadi semakin parah. Hal ini diperparah dengan tidak adanya antivirus maupun Vaksin untuk infeksi dengue. Penelitian ini bertujuan untuk melakukan desain primer untuk amplifikasi gen Non Structural -3 (NS-3) serotype 2 (DENV-2) strain Indonesia (AB189124) yang bisa disisipkan pada plasmid pPICZ-alphaA dan diekspresikan pada vektor Pichia pastoris. Hasil penelitian didapatkan pasangan primer yang dapat digunakan untuk membuat protein rekombinan NS-3 DENV-2. Pasangan primer tersebut adalah pasangan CGC + KpnI + Primer (4468) = CGC + GGTACC + TCCCGTGTCAATACCAATCA dan SacII + Primer (6495) = CCGCGG + AGCATGATTGTACGCCCTTC. Dengan mempertimbangkan sekuens keseluruhan gen NS-3 DENV-2, epitope, dan enzim restriksi pada plasmid dan NS-3, maka pasangan primer tersebut dapat digunakan untuk membuat protein rekombinan NS-3 DENV-2 sebagai kandidat Vaksin dengue.

Dengue Fever is a major health problem which threatens a lot of tropical countries, including Indonesia. In the last few years, this epidemic grew worse. This was aggravated by the nonexistence of neither vaccine nor antivirus capable of neutralizing dengue virus serotype 1-4. This research focused on designing primer for amplification of Non Structural-3 (NS-3) dengue virus serotype 2 (DENV-2) Indonesian strain (AB189124) which could be spliced into pPICZ-alhpaA and expressed on Pichia pastoris vector. Research result was a primer pair which could be used to produce NS-3 DENV-2 recombinant protein. These primer pair were CGC + KpnI + Primer (4468) = CGC + GGTACC + TCCCGTGTCAATACCAATCA dan SacII + Primer (6495) = CCGCGG + AGCATGATTGTACGCCCTTC. By considering overall sequence of NS-3 DENV-2 genes, epitope, and restriction enzyme on plasmid and NS-3, these primer pair could be use to produce NS-3 DENV-2 recombinant protein as a dengue vaccine candidate."
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2012
S-Pdf
UI - Skripsi Membership  Universitas Indonesia Library
cover
Indra Wicaksono
"Infeksi virus Dengue (DENV) masih menjadi masalah kesehatan dunia termasuk Indonesia, mengamcam lebih dari 150 ribu jiwa setiap tahunnya. Meski berbagai usaha preventif konvensional telah dilakukan, angka keparahan tetap tidak jauh berkurang. Karena itu, vaksin dikembangkan sebagai usaha preventif yang efektif sekaligus efisien. Sayangnya, jumlah studi filogenetik yang mendukung pengembangan vaksin saat ini masih terbatas. Untuk itu, penelitian ini dilakukan dengan menganalisis sekuens nukleotida dan asam amino protein Non Struktural-1 (NS-1) pada bagian epitope. Analisis dilakukan dari data yang dikumpulkan melalui GenBank dan Laboratorium Mikrobiologi Fakultas Kedokteran Universitas Indonesia, 29 sekuens diolah menggunakan program Genetyx 5.1. Hasil analisis menunjukkan persebaran filogenetik berdasarkan nukleotida NS-1 strain Indonesia yang berada pada Genotipe I dan IV dan tidak berbeda dengan filogenetik berdasarkan gen envelope. Sedangkan, hasil homologi asam amino menunjukkan substitusi terjadi pada beberapa situs epitope NS-1 yang sebelumnya dianggap lestari. Hasil ini menunjukkan bahwa, analisis NS-1 dapat digunakan sebagai dasar pengembangan vaksin dengue.

Until to date, dengue virus (DENV) infection is still a major global health problem including Indonesia, putting over 150 thousands people at risk every year. Despite various conventional preventive efforts conducted, number of people with severe dengue is not reduce significantly. Vaccine is than developed in a hope to make a more effective and efficient way of dengue prevention. But, only a limited number of phylogenetic studies have been conducted to support the vaccine development. This phylogenetic studies of dengue virus (DENV) is conducted in order to support the basis for development of protective dengue vaccine. This study analyze nucleotides and amino acids sequence of Non Structural-1 (NS-1) protein and emphasizing at epitope sites. By using Genetyx 5.1, 29 samples that have been collected from Laboratory of Microbiology Faculty of Medicine Universitas Indonesia and GenBank were analized. Phylogenetic tree analysis using NS-1 nucleotides showing that isolates from Indonesia is potitioned within genotipe I and IV, insignifically different with phylogenetic tree analysis using envelope nucleotides. While, amino acid homology analysis showing subtitution between NS1 epitope sites that considered being conserved at the previous studies. This results shows that, NS-1 analysis can be used as a basis of vaccine development."
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2014
S-Pdf
UI - Skripsi Membership  Universitas Indonesia Library
cover
Tika Widayanti
"Infeksi dengue DENV adalah penyakit yang diperantarai nyamuk yang manifestasinya dapat mengarah pada dengue hemorrhagic fever DHF dan/atau dengue shock syndrome DSS yang dapat mengakibatkan kematian. Di Indonesia, DHF sudah endemis dan menjadi penyakit yang terjadi sepanjang tahun. Protein non struktural-1 NS1 dari DENV diketahui merupakan biomarker dalam diagnosis dengue karena protein ini bersirkulasi dalam darah selama fase akut penyakit. Penelitian ini bertujuan untuk mengembangkan antibodi monoklonal mAb untuk mendeteksi antigen NS1 dari DENV serotipe 3 DENV3. Sel hibridoma penghasil mAb diperoleh dengan memfusikan sel B dari mencit yang diimunisasi dengan antigen NS1 yang diekspresikan pada sel CHO-K1 dengan sel PAI myeloma. Seleksi hibridoma dengan ELISA indirect diperoleh 16 klona yang berpotensi menghasilkan antibodi anti-NS1.
Tujuh klona terbaik dipilih untuk dikarakterisasi dengan metode IFA terhadap antigen rekombinan NS1 dan hasilnya 6 klona positif menunjukkan reaksi sinyal fluoresens. Klona mAb 4-2D, 4-4F, dan 2-7A diuji terhadap protein NS1 native dari DENV1, DENV2, DENV3, dan DENV4, dan ketiga mAb tersebut mampu mengenali secara spesifik protein NS1 dan tidak bereaksi terhadap protein virus yang lain. Terdapat reaktivitas silang dengan 3 serotipe lainnya yang mengindikasikan bahwa mAb yang diujikan mengenali epitop lestari antigen NS1. Analisis prediksi epitop NS1 juga dilakukan secara in silico terhadap beberapa strain DENV lainnya. Namun, studi lebih lanjut mengenai pemetaan epitop dan afinitas pengikatan antigen-antibodi perlu dilakukan untuk menentukan mAb yang paling potensial sebagai bahan baku kit diagnostik.

Dengue DENV is a mosquito borne infection disease which its manifestation can be lead to a lethal dengue hemorrhagic fever DHF and or dengue shock syndrome DSS . In Indonesia, DHF has been endemic and the disease occurs throughout the year. Non structural 1 NS1 protein of DENV is known to be a biomarker in dengue diagnosis since the protein is abundantly circulating in the blood during acute phase of the disease. The aim of this study to develop monoclonal antibodies mAbs derived from DENV3 to detect NS1. Hybridoma mAb producing cells were obtained by fusing B cells from an immunized mice with NS1 antigen expressed on CHO K1 cells, with PAI myeloma cells. Hybridoma selection with indirect ELISA showed 16 clones that could be potentially produce anti NS1 antibodies.
Seven up to sixteen clones were selected to be characterized by IFA against recombinant NS1 antigen and the result showed 6 clones produce fluorescence signals. Clones mAb 4 2D, 4 4F, and 2 7A were tested against native NS1 proteins from DENV1, DENV2, DENV3, and DENV4, and these mAbs were able to recognize specifically NS1 protein and did not react against other viral proteins. There is a cross reactivity within 3 other serotypes which initially indicate that mAbs recognizes the conserved epitopes determinant of the NS1 antigen. Epitopes prediction analysis was also performed in silico against several others DENV strains. However, further studies of epitope mapping and antigen antibody binding affinity are necessary to determine the most potential mAbs for diagnostic tools.
"
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2017
T-Pdf
UI - Tesis Membership  Universitas Indonesia Library
cover
Siregar, Tegar Adriansyah Putra
"Infeksi yang disebabkan oleh virus dengue (DENV) menimbulkan spektrum luas penyakit dari sindrom virus ringan, demam dengue klasik dan penyakit perdarahan berat yaitu demam berdarah dengue (DBD) hingga Dengue Shock Syndrom (DSS). Antibodi terhadap protein struktural E dari serotipe DENV yang heterolog pada infeksi primer dan sekunder tidak dapat menetralkan virus, sehingga walaupun kompleks antibodi-virus difagositosis oleh monosit, DENV tetap dapat bereplikasi di dalam monosit. Kondisi meningkatnya infeksi virus pada sel target diperantarai antibodi ini dikenali sebagai antibody-dependent enhancement (ADE). Protein NS3 merupakan protein terbesar kedua yang dikode oleh genom DENV dan sekuens asam amino primernya merupakan yang paling lestari diantara serotipe DENV yang berguna menghindari ADE. Protein NS3 ditemukan menginduksi respon antibodi dan respon sel T CD4+ dan CD8+, kebanyakan sel T tersebut bereaksi silang antar serotipe. Dilakukan analisis pada epitop sel T dan sel B protein NS3 DENV4 081 yang selanjutnya dilakukan pengklonaan dan ekspresi gen NS3 DENV4 081. Ditemukan posisi epitop sel B 537-544 NS3 DENV4 081 identik dan lestari dengan 124 strain DENV4 di dunia dan dengan keempat serotipe strain Indonesia. Gen NS3 DENV4 081 berhasil diamplifikasi dengan teknik PCR dan berhasil diinsersikan kedalam vektor pQE80L dengan orientasi yang benar. Plasmid rekombinan yang mengandung gen NS3 DENV4 081 ditransformasikan ke dalam E. coli BL21 dan diekspresikan dengan induksi IPTG. Hasil ekspresi protein NS3 DENV4 081 yang ditunjukkan dengan terlihatnya dot yang berwarna lebih pekat pada Dot Blot yang dideteksi dengan detektor anti-His merupakan protein rekombinan NS3 DENV4 081. Hasil Western Blot menunjukkan ekspresi protein rekombinan NS3 yang rendah, sehingga masih perlu penelitian lebih lanjut untuk mengoptimalkan ekspresi protein rekombinan NS3 pada vektor pQE80L.

Infections caused by dengue virus (DENV) cause a broad spectrum of disease from mild viral syndrome, classic dengue fever to severe hemorrhagic diseases which are dengue hemorrhagic fever (DHF) and Dengue Shock Syndrome (DSS). Antibodies against E protein of heterologous DENV serotypes in primary and secondary infections can not neutralize the virus, although the antibody-virus complexes were phagocytes by monocytes, DENV still replicate inside monocytes. A condition increasing antibody-mediated viral infection on target cell was identified as antibody-dependent enhancement (ADE). NS3 protein is the second largest protein encoded by the genome of DENV and the primary amino acid sequence is the most conserved among DENV serotypes. NS3 protein was found to induce antibody, CD4+ and CD 8+ T cell responses, most of the T cells were cross-reactive between serotypes. Analysis was performed on the T and B cell epitope of NS3 DENV4 081 protein then continue with gene cloning and expression of NS3 DENV4 081. Position of B cell epitope 537-544 NS3 DENV4 081 protein was found identical and conserved to NS3 protein of 124 DENV4 strains around the world and all four serotypes of Indonesia strain. NS3 DENV4 081 gene was successfully amplified by PCR and successfully inserted into the vector pQE80L with the correct orientation. Recombinant plasmid containing NS3 DENV4 081 gene was transformed into E. coli BL21 and expressed by IPTG induction. Results of NS3 DENV4 081 protein expression was indicated by the colored dot produced on Dot Blot detected with anti-His detector. Western Blot result show low NS3 recombinant protein expression, so further research is needed to optimize the NS3 expression in vector pQE80L."
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2014
T-Pdf
UI - Tesis Membership  Universitas Indonesia Library
cover
Siti Rayhani Fadhila
"Demam berdarah merupakan salah satu masalah kesehatan di dunia. Infeksi virus dengue yang berulang dengan serotipe yang berbeda dapat memacu terjadinya demam berdarah bahkan kematian. Dengue serotipe 4 dilaporkan dapat menyebabkan infeksi sekunder yang lebih parah dibandingkan dengue serotipe lainnya. Sampai saat ini pengobatan demam berdarah belum ditemukan, maka itu pencegahan jauh lebih penting.
Para peneliti telah merekomendasikan vaksin aman berbasis nonstructural protein 1 (NS1) karena sifat imunogeniknya. Mereka telah mengidentifikasi empat epitope di NS1 yang diduga bereaksi kuat dengan epitope B cells, yaitu LD2, 24A, LX1, 24C. Tujuan dari riset ini adalah untuk menganalisa dan membandingkan strain DENV-4 yang diisolasi di Jakarta 2010 dengan 34 strain DENV-4 lainnya yang didapat dari GenBank menggunakan UGENE software sebagai basis dari pengembangan vaksin. Penelitian ini menggunakan data sekunder berupa urutan nukelotida virus dengue serotipe 4 strain IDSS44/10 yang diamplifikasi dan diurutkan di Departemen Mikrobiologi, FKUI.
Dari hasil penelitian ini dapat disimpulkan bahwa gen NS1 dari DENV-4 strain IDSS44/10 dapat digunakan sebagai kandidat vaksin dengue di masa mendatang. Hasil menunjukkan bahwa epitope 24C menunjukkan motif yang homolog di setiap sekuens asam amino pada NS1 DENV-4. Hampir seluruh DENV-4 strain yang diisolasi termasuk IDSS44/2010 memiliki urutan asam amino yang sama pada epitop LD2, 24A, LX1, 24C.

Dengue hemorrhagic fever has become a worldwide issue. Heterologous infection by different serotypes may lead to this advanced stage of dengue infection and even death. Dengue virus serotype 4 has been reported to cause more severe secondary infection compared to other serotypes. To date, there is no specific treatment for this disease therefore prevention is much more important.
Researchers have proposed a safe vaccine strategy that is based on nonstructural protein 1 (NS1) as it is strongly immunogenic. They identified four epitopes on NS1 that reacted strongly to B cell epitopes which are LD2, 24A, LX1, and 24C. The goal of this research is to identify and compare these NS1 epitopes among DENV-4isolated in Indonesia 2010 with other DENV-4 strains using UGENE softwareas a base of vaccine development. This study used a nucleotide sequence data of DENV-4 strain IDSS44/10 that was amplified and sequenced in Microbiology Department, FKUI.
The results show that NS1 gene DENV-4, IDSS44/2010 strain could be used as a dengue vaccine candidate in the future.The results show that 24C epitope was highly conserved among 35 DENV-4 NS1 sequences. Most of the DENV-4 including IDSS44/10 Indonesian strain have similar amino acids sequences on the epitopes (LD2, 24A, LX1, and 24C).
"
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2013
S-Pdf
UI - Skripsi Membership  Universitas Indonesia Library
cover
Lenggo Geni
"[ABSTRAK
Demam berdarah dengue (DBD) merupakan penyakit yang disebabkan karena
infeksi virus dengue (DENV), yang banyak ditemukan di Indonesia. Belum ada
terapi yang spesifik dalam pengobatan DBD. Upaya pengembangan vaksin
dengue yang efektif sangat diperlukan. Pada penelitian ini dilakukan analisa
imunogenisitas kandidat vaksin DNA prM-E dengue serotipe 2 (pUMD2.kl.20)
dengan menganalisis sel T CD4, sel T CD8, IFN-γ dan TNF-α. pada sel U937 dan
PBMC secara in vitro, bertujuan untuk mengetahui respon imun ketika vaksin
diinjeksikan ke dalam tubuh manusia. Dasar penelitian ini adalah sel U937
ditransfeksi dengan pUMD2.kl.20 menggunakan lipofectamin. Sel U937 akan
berperan sebagai APCs yang akan mengekspresikan protein prM-E DENV-2 dan
mempresentasikan protein tersebut melalui molekul MHC class I dan MHC class
II kepada Peripheral Blood Mononuclear Cell (PBMC) manusia. Tahapan kerja
yang dilakukan dalam penelitian ini terdiri dari: (a) kultur galur sel U937, (b)
transfeksi sel U937 dengan pUMD2.kl.20, (c) transfeksi sel U937 dengan plasmid
s(pUMVC), (d) infeksi sel U937 dengan DENV-2 strain DS.18/09, (e) pewarnaan
dan pengamatan hasil pewarnaan menggunakan alat semi flowcytometri (TALI).
pUMD2.kl.20 mengaktivasi sel T CD4 dan sel T CD8 untuk berploriferasi. Hasil
penelitian ini menunjukkan bahwa konsentrasi sel T CD8 lebih tinggi dari
konsentrasi sel T CD4 dan konsentrasi sel positif yang mensekresikan IFNγ lebih
tinggi dari konsentrasi sel positif yang mensekresikan TNFα. Kondisi optimal dari
aktivasi sel T CD4 oleh pUMD2.kl.20 adalah 24 jam setelah penambahan PBMC
setelah transfeksi (8,53x10⁴sel/ml), untuk sel T CD8 adalah 24 jam setelah
penambahan PBMC setelah transfeksi (49,4x10⁴ sel/ml). Kondisi optimal dari
aktivasi sel+ yang mensekresikan IFNγ oleh pUMD2.kl.20 adalah 24 jam setelah
penambahan PBMC 48 jam setelah transfeksi (9,86x10⁴ sel/ml), dan untuk sel+
yang mensekresikan TNFα adalah 2 jam setelah penambahan PBMC 48 jam
setelah transfeksi (2,1x10⁴ sel/ml). Dari penelitian ini dapat disimpulkan bahwa
pUMD2.kl.20 bersifat imunogenik.

ABSTRACT
Dengue hemorrhagic fever (DHF) is a disease caused by infection with dengue
virus (DENV), which is found in Indonesia. There is no specific therapy in the
treatment of DHF. An effort to develop an effective dengue vaccine is needed. In
this research, analysis of the immunogenicity of the DNA vaccine candidate prME
dengue serotype 2 (pUMD2.kl.20) by analyzing the CD4 T cells, CD8 T cells,
IFN-γ and TNF-α in U937 cells and PBMC in vitro, aims to determine the
immune response when the vaccine is injected into the human body. This research
approach is based on transfection of U937 cells with pUMD2.kl.20 using
lipofectamin. U937 cells acts as APCs which will express the protein prM-E
DENV-2 and presenting these proteins through the MHC class I and MHC class II
molecule to the Peripheral Blood Mononuclear Cell (PBMC) of human body.
Stages of the work in this study consisted of: (a) culture cell line U937, (b)
transfection of U937 cells with pUMD2.kl.20, (c) transfection of U937 cells with
plasmid (pUMVC), (d) infection of U937 cells with DENV-2 strains DS.18/09,
(e) staining and observation results of staining using a semi-flow cytometri
(TALI). pUMD2.kl.20 activate CD4 T cells and CD8 T cells to proliferate. CD8 T
cells concentration higher than the concentration of CD4 T cells and the secretion
of INFγ-positive cells concentration higher than the concentration of the secretion
of TNFα-positive cells. Optimal condition of CD4 T cells activation by
pUMD2.kl.20 is 24 hours after the addition of PBMC after transfection (8,53x10⁴
cells/ml), for CD8 T cells was 24 hours after the addition of PBMC after
transfection (49,4x10⁴ cells/ml). Optimal conditions secretion of IFNγ-positive
cells were activated by pUMD2.kl.20 is 24 hours after the addition of PBMC 48
hours after transfection (9,86x10⁴ cells/ml), and for the secretion of TNFα-
positive cells were activated by pUMD2.kl.20 is 2 hours after the addition of
PBMC 48 hours after transfection (2,1x10⁴ cells/ml). From this study it can be
concluded that the pUMD2.kl.20 immunogenic, Dengue hemorrhagic fever (DHF) is a disease caused by infection with dengue
virus (DENV), which is found in Indonesia. There is no specific therapy in the
treatment of DHF. An effort to develop an effective dengue vaccine is needed. In
this research, analysis of the immunogenicity of the DNA vaccine candidate prME
dengue serotype 2 (pUMD2.kl.20) by analyzing the CD4 T cells, CD8 T cells,
IFN-γ and TNF-α in U937 cells and PBMC in vitro, aims to determine the
immune response when the vaccine is injected into the human body. This research
approach is based on transfection of U937 cells with pUMD2.kl.20 using
lipofectamin. U937 cells acts as APCs which will express the protein prM-E
DENV-2 and presenting these proteins through the MHC class I and MHC class II
molecule to the Peripheral Blood Mononuclear Cell (PBMC) of human body.
Stages of the work in this study consisted of: (a) culture cell line U937, (b)
transfection of U937 cells with pUMD2.kl.20, (c) transfection of U937 cells with
plasmid (pUMVC), (d) infection of U937 cells with DENV-2 strains DS.18/09,
(e) staining and observation results of staining using a semi-flow cytometri
(TALI). pUMD2.kl.20 activate CD4 T cells and CD8 T cells to proliferate. CD8 T
cells concentration higher than the concentration of CD4 T cells and the secretion
of INFγ-positive cells concentration higher than the concentration of the secretion
of TNFα-positive cells. Optimal condition of CD4 T cells activation by
pUMD2.kl.20 is 24 hours after the addition of PBMC after transfection (8,53x10⁴
cells/ml), for CD8 T cells was 24 hours after the addition of PBMC after
transfection (49,4x10⁴ cells/ml). Optimal conditions secretion of IFNγ-positive
cells were activated by pUMD2.kl.20 is 24 hours after the addition of PBMC 48
hours after transfection (9,86x10⁴ cells/ml), and for the secretion of TNFα-
positive cells were activated by pUMD2.kl.20 is 2 hours after the addition of
PBMC 48 hours after transfection (2,1x10⁴ cells/ml). From this study it can be
concluded that the pUMD2.kl.20 immunogenic]"
2015
T-Pdf
UI - Tesis Membership  Universitas Indonesia Library
cover
Lola Febriana Dewi
"ABSTRAK
Infeksi yang disebabkan oleh virus dengue telah banyak dilaporkan di negara tropis dan subtropis. Virus dengue terdiri dari 4 serotipe yaitu dengue 1-4. Hingga saat ini belum tersedia vaksin yang berlisensi untuk mencegah terjadinya infeksi dengue. Pada penelitian ini dikonstruksi vaksin DNA yang mengkode gen prM-E dan prM-E-NS1del virus dengue 2 strain Indonesia yang akan dijadikan sebagai kandidat vaksin dengue. Hasil penelitian berhasil mendapatkan 9 plasmid rekombinan pUMDE2 yang membawa gen sisipan prM-E dan telah dikonfirmasi dengan melakukan PCR koloni dan restriksi plasmid. Dari hasil sekuensing plasmid pUMDE2 koloni no. 11 ditemukan 19 mutasi asam amino pada gen prM-E, sepuluh mutasi pada gen prM dan sembilan mutasi pada gen E. Mutasi protein prM N29D dan N52K serta protein E V164I dan S390N terletak pada daerah epitop pengenalan sel B. Transfeksi plasmid pUMDE2 dilakukan pada sel Chinese Hamster Ovary (CHO)-K1 dan menunjukkan adanya ekspresi protein prM-E rekombinan berdasarkan uji imunostaining dan ELISA. Hasil ELISA menunjukkan bahwa protein ditemukan pada sel yang ditransfeksi. Sedangkan, plasmid rekombinan yang membawa gen prM-E-NS1del tidak berhasil dikonstruksi. Plasmid pUMDE2 dapat dikembangkan menjadi kandidat vaksin DNA.

ABSTRACT
Infection by dengue virus were reported in tropical and subtropical area. Dengue virus (DENV) consist of 4 serotype, DENV-1 to DENV-4. There is no licensed vaccine available for dengue infection. In this research, we construct DNA vaccine encode prM-E and prM-E-NS1del genes of dengue virus serotype 2 for vaccine development. Nine recombinant plasmids that encode prM-E genes (pUMDE2), were successfully obtained. Recombinant plasmids were confirmed by PCR colony and restriction enzyme analysis. Colony of pUMDE2 no. 11 was sequenced and total 19 amino acid mutations were founds, 10 mutations in prM and 9 mutations in E protein. prM mutations N29D and N52K, E mutations of V164I and S390N were found in B cell epitopes. Transfection pUMDE2 plasmid was done to Chineese Hamster Ovary (CHO)-K1 and showed that recombinant protein prM-E was successfully expressed by immunostaining assay and ELISA. Results showed that the protein was mainly found in cell fraction. However, recombinant plasmid that encode prM-E-NS1del were failed to be constructed. pUMDE2 could be developed for vaccine candidate.
"
Jakarta: Fakultas Kedokteran Universitas Indonesia, 2016
T-Pdf
UI - Tesis Membership  Universitas Indonesia Library
cover
Stefani
"Infeksi virus dengue (DENV) masih menjadi salah satu penyakit yang sering terjadi di dunia dan tak jarang menimbulkan kematian. Diagnosis dini yang akurat diperlukan untuk memberikan pengobatan yang tepat. Karena Indonesia merupakan negara kepulauan, metode deteksi menggunakan PCR menjadi kurang efektif sehingga alat berbasis lateral flow assay (LFA) yang menggunakan antibodi monoklonal sebagai biosensor-nya dapat menjadi solusi. Pengembangan nanobodi yang berasal dari hewan Camelidae dapat mengatasi kelemahan antibodi monoklonal karena kelarutannya yang tinggi, stabilitas yang lebih baik, dan dapat dimanipulasi secara genetik. Dengan menggunakan nanobodi yang telah diproduksi sebelumnya oleh Asih et al. (2022) dalam E. coli yang dapat mendeteksi infeksi DENV, maka selanjutnya dilakukan evaluasi menggunakan metode surface plasmon resonance (SPR) untuk mendapatkan parameter kinetika pada interaksi antara nanobodi dengan protein NS1 sebagai biomarker infeksi DENV. Penelitian diawali dengan perbanyakan kultur E. coli, ekspresi nanobodi dengan induksi IPTG, pemurnian nanobodi, konfirmasi hasil perolehan nanobodi dengan SDS-PAGE dan Western Blot, lalu diakhiri dengan uji SPR. Secara umum, respon sinyal SPR menunjukkan bahwa nanobodi klon DD5 dan DD7 mampu berinteraksi dan berikatan dengan antigen NS1 DENV-2. Nilai KD yang diperoleh saat ligan DD5 berinteraksi dengan variasi konsentrasi NS1 DENV-2 adalah 1,08 x 10-7 M. Sementara itu, nilai KD yang diperoleh saat ligan NS1 berinteraksi dengan variasi konsentrasi DD5 dan DD7 secara berturut-turut adalah sebesar 9,62 x 10-8 M dan 9,29 x 10-8 M.

Dengue virus infection (DENV) is still one of the most common diseases in the world and sometimes causes death. Accurate early diagnosis is necessary to provide the right treatment. Because Indonesia is an archipelagic country, the detection method using PCR is less effective so a lateral flow assay (LFA) based tool that utilizes antibodies as its biosensor can be a solution. Developing nanobodies derived from Camelidae may overcome the drawbacks of monoclonal antibodies because they have higher solubility, better stability, and can be manipulated genetically. By using nanobodies previously produced by Asih et al. (2022) in E. coli which can detect DENV infection, the next step is to evaluate by using the surface plasmon resonance (SPR) method to obtain kinetic parameters on the interaction between nanobodies and NS1 protein as biomarkers of DENV infection. The study started with the preparation of E. coli culture, then continued with the expression of nanobodies by IPTG induction, purification of nanobodies, confirmation of nanobody acquisition by SDS-PAGE and Western Blot, then ended with the SPR test. Overall, both DD5 and DD7 appeared to be able to interact and bind to the NS1 DENV-2 antigen, according to the SPR signal response. The KD value obtained when the DD5 ligand interacted with various concentrations of NS1 DENV-2 was 1,08 x 10-7. Meanwhile, the KD values obtained when the NS1 ligand interacted with various concentrations of DD5 and DD7 were 9,62 x 10-8 and 9,29 x 10-8 respectively."
Depok: Fakultas Teknik Universitas Indonesia, 2023
T-pdf
UI - Tesis Membership  Universitas Indonesia Library
cover
Wahyu Hidayati
"ABSTRAK
Infeksi dengue merupakan salah satu masalah kesehatan utama di Indonesia.
Perubahan manifestasi klinis yang cepat dari ringan hingga berat bahkan kematian
menyebabkan perlunya pendeteksian dini infeksi dengue. Salah satu metode
deteksi yang potensial untuk diterapkan sebagai pendeteksian dini adalah
pendeteksian antigen NS1 dengue. Penelitian ini bertujuan untuk mendapatkan
protein rekombinan NS1 dengue serotipe 4 strain Indonesia dengan menggunakan
sistem Pichia pastoris yang dapat digunakan untuk pembuatan antibodi anti-NS1.
Sampel yang digunakan adalah RNA virus dengue serotipe 4 strain Indonesia IDS
96/10. Metode penelitian adalah ekperimental yang meliputi pembuatan cDNA,
pengklonaan pada bakteri Escherichia coli, skrining sel transforman, sekuensing,
transformasi sel P. pastoris strain X-33, analisa fenotipe, dan ekspresi protein.
Diperoleh 6 koloni P. pastoris strain X-33 rekombinan dengan fenotipe Mut+ dan
terdeteksi protein rekombinan NS1 dengue serotipe 4 dengan ukuran antara 72
hingga 95 kDa pada protein standard, diperkirakan berukuran 80 kDa. Hasil
analisa nukleotida dan asam amino menunjukkan tidak terjadi mutasi pada gen
NS1 dan terletak pada in frame yang sesuai pada vektor pPICZαB. Protein NS1
yang diperoleh diharapkan dapat merangsang terbentuknya antibodi anti-NS1
yang selanjutnya dapat digunakan untuk mendeteksi antigen NS1 pada serum
pasien.

ABSTRACT
Dengue infection is a major health problem in Indonesia. Clinical manifestation
rapidly changing from mild to severe even death. Therefore early detection
becomes very important. One of potential detection methods to be applied as an
early detection is NS1 dengue antigen detection. The aim of this research was to
express NS1 recombinant protein of dengue virus serotype 4 strain Indonesia
using Pichia pastoris. Dengue virus RNA from infected pasien serum IDS 96/10
was used in this research. To get recombinant protein we constructed NS1
recombinant plasmid in vector P. pastoris. First, we amplified NS1 gene and
cloned it to Escherichia coli. We selected transformant cells and and recombinant
plasmid was transfected to yeast by electroporation. We selected yeast
transformants and analized the phenotype. Methanol was used to induce
expression recombinant protein. Protein expression was determined by SDSPAGE
and Western Blot. By Western Blot using antibody to dengue viruses, we
found protein recombinant with molecular weight around 72-95 kDa. This size
was similar with dimer of NS1 size. In the future, this recombinant protein can be
used to produce antibody anti-NS1 that able to detect NS1 antigen in patient sera."
Fakultas Kedokteran Universitas Indonesia, 2012
T-Pdf
UI - Tesis Membership  Universitas Indonesia Library
<<   1 2 3 4 5 6 7 8 9 10   >>