Hasil Pencarian  ::  Simpan CSV :: Kembali

"Indonesia merupakan negara dengan jumlah kasus dengue terbanyak dan terparah di Asia Tenggara Studi filogenetik virus dengue DENV diperlukan sebagai dasar pengembangan struktur vaksin yang cocok Meskipun demikian data sekuens DENV masih terbatas Penelitian ini bertujuan menganalisis sekuens dan filogenetik keseluruhan gen envelope DENV 1 dibandingkan dengan domain III saja Data didapatkan dari GenBank dan Laboratorium Mikrobiologi Fakultas Kedokteran Universitas Indonesia berupa whole genome DENV 1 sebanyak 30 sekuens yang diolah dengan Genetyx 5 1 Hasil analisis nukleotida gen envelope DENV 1 menunjukan strain Indonesia termasuk genotipe I dan IV Sedangkan analisis nukleotida dengan hanya domain III menunjukan adanya perbedaan cluster antar strain namun tetap dalam genotipe yang sama Dengan demikian studi filogenetik penentuan genotipe dapat dilakukan dengan hanya menggunakan domain III saja Analisis homologi asam amino domain III menunjukan epitope utama dilestarikan dan dapat menjadi landasan penting dalam pembuatan vaksin dengue berbasis domain III

---

Phylogenetic study of dengue virus DENV is required as a basis to develop a suitable structure for vaccine development Nonetheless DENV sequence data is limited This study aims to analyze and compare the sequence and phylogenetic of DENV 1 envelope gene with domain III The data is obtained from GenBank and Laboratory of Microbiology Faculty of Medicine Universitas Indonesia Thirty sequences of DENV 1 whole genome were processed using Genetyx 5 1 Analysis using DENV 1 envelope nucleotide showed that strain Indonesia has genotype I and IV Analysis using only the nucleotide of domain III showed the same genotype with difference of clusters between strains Thus phylogenetic studies determining the genotype can be done using domain III alone Homology analysis of amino acid of domain III showed that the main epitope is well reserved This finding can be an important cornerstone in the development of domain III based dengue vaccine."

"Infeksi virus Dengue (DENV) masih menjadi masalah kesehatan dunia termasuk Indonesia, mengamcam lebih dari 150 ribu jiwa setiap tahunnya. Meski berbagai usaha preventif konvensional telah dilakukan, angka keparahan tetap tidak jauh berkurang. Karena itu, vaksin dikembangkan sebagai usaha preventif yang efektif sekaligus efisien. Sayangnya, jumlah studi filogenetik yang mendukung pengembangan vaksin saat ini masih terbatas. Untuk itu, penelitian ini dilakukan dengan menganalisis sekuens nukleotida dan asam amino protein Non Struktural-1 (NS-1) pada bagian epitope. Analisis dilakukan dari data yang dikumpulkan melalui GenBank dan Laboratorium Mikrobiologi Fakultas Kedokteran Universitas Indonesia, 29 sekuens diolah menggunakan program Genetyx 5.1. Hasil analisis menunjukkan persebaran filogenetik berdasarkan nukleotida NS-1 strain Indonesia yang berada pada Genotipe I dan IV dan tidak berbeda dengan filogenetik berdasarkan gen envelope. Sedangkan, hasil homologi asam amino menunjukkan substitusi terjadi pada beberapa situs epitope NS-1 yang sebelumnya dianggap lestari. Hasil ini menunjukkan bahwa, analisis NS-1 dapat digunakan sebagai dasar pengembangan vaksin dengue.

---

Until to date, dengue virus (DENV) infection is still a major global health problem including Indonesia, putting over 150 thousands people at risk every year. Despite various conventional preventive efforts conducted, number of people with severe dengue is not reduce significantly. Vaccine is than developed in a hope to make a more effective and efficient way of dengue prevention. But, only a limited number of phylogenetic studies have been conducted to support the vaccine development. This phylogenetic studies of dengue virus (DENV) is conducted in order to support the basis for development of protective dengue vaccine. This study analyze nucleotides and amino acids sequence of Non Structural-1 (NS-1) protein and emphasizing at epitope sites. By using Genetyx 5.1, 29 samples that have been collected from Laboratory of Microbiology Faculty of Medicine Universitas Indonesia and GenBank were analized. Phylogenetic tree analysis using NS-1 nucleotides showing that isolates from Indonesia is potitioned within genotipe I and IV, insignifically different with phylogenetic tree analysis using envelope nucleotides. While, amino acid homology analysis showing subtitution between NS1 epitope sites that considered being conserved at the previous studies. This results shows that, NS-1 analysis can be used as a basis of vaccine development."

"Kondisi iklim tropis Indonesia menyebabkan Indonesia menjadi salah satu kontributor kasus infeksi DENV terbanyak. Saat ini diperlukan pengembangan vaksin yang harus didasari oleh studi filognetik virus, khususnya DENV serotipe 2 (DENV-2) yang merupakan DENV serotipe paling dominan di Indonesia. Penelitian ini bertujuan untuk menganalisa perbandingan sekuens dan filogenetik nukleotida Envelope lengkap dengan Domain III. Sejumlah 42 data diambil dari GenBank dan Laboratorium Mikrobiologi Fakultas Kedokteran Universitas Indonesia berupa sekuens whole genome DENV-2. Sekuens tersebut diolah dengan software Genetyx 5.1. Hasil penelitian menunjukan strain Indonesia merupakan genotipe Cosmopolitan. Sedangkan analisis filogenetik Envelope lengkap dan Domain III menunjukkan perbedaan. Genotipe Asia II menjadi bagian genotipe American pada analisis filogenetik Domain III. Dari hasil penelitian dapat disimpulkan bahwa filogenetik Domain III saja tidak dapat digunakan untuk penentuan genotipe.

---

Indonesia's tropical climate conditions caused Indonesia become one of the largest contributors of DENV infection. Currently, we required the development of a vaccine that must be based on studies phylogenetic virus, in particular 2 DENV serotypes (DENV-2) which is the most predominant serotype DENV in Indonesia. This study aims to analyze the nucleotide sequence comparisons and phylogenetic complete Envelope with Domain III. A total of 42 data retrieved from GenBank and the Laboratory of Microbiology, Faculty of Medicine, University of Indonesia in the form of whole genome sequences of DENV-2. The sequence processed with GENETYX 5.1 software. The results showed Indonesia strain is part of Cosmopolitan genotype. Whereas the Envelope epitope analysis and the Domain III epitope analysis show significant differences. Genotype Asian II became part of the American genotype on phylogenetic analysis of Domain III. From the results of this study concluded that the phylogenetic domain III alone cannot be used for the determination genotpe."

"Demam berdarah merupakan sebuah masalah kesehatan besar yang mengancam banyak negara tropis, termasuk Indonesia. Beberapa tahun terakhir penyakit ini berkembang menjadi semakin parah. Hal ini diperparah dengan tidak adanya antivirus maupun Vaksin untuk infeksi dengue. Penelitian ini bertujuan untuk melakukan desain primer untuk amplifikasi gen Non Structural -3 (NS-3) serotype 2 (DENV-2) strain Indonesia (AB189124) yang bisa disisipkan pada plasmid pPICZ-alphaA dan diekspresikan pada vektor Pichia pastoris. Hasil penelitian didapatkan pasangan primer yang dapat digunakan untuk membuat protein rekombinan NS-3 DENV-2. Pasangan primer tersebut adalah pasangan CGC + KpnI + Primer (4468) = CGC + GGTACC + TCCCGTGTCAATACCAATCA dan SacII + Primer (6495) = CCGCGG + AGCATGATTGTACGCCCTTC. Dengan mempertimbangkan sekuens keseluruhan gen NS-3 DENV-2, epitope, dan enzim restriksi pada plasmid dan NS-3, maka pasangan primer tersebut dapat digunakan untuk membuat protein rekombinan NS-3 DENV-2 sebagai kandidat Vaksin dengue.

---

Dengue Fever is a major health problem which threatens a lot of tropical countries, including Indonesia. In the last few years, this epidemic grew worse. This was aggravated by the nonexistence of neither vaccine nor antivirus capable of neutralizing dengue virus serotype 1-4. This research focused on designing primer for amplification of Non Structural-3 (NS-3) dengue virus serotype 2 (DENV-2) Indonesian strain (AB189124) which could be spliced into pPICZ-alhpaA and expressed on Pichia pastoris vector. Research result was a primer pair which could be used to produce NS-3 DENV-2 recombinant protein. These primer pair were CGC + KpnI + Primer (4468) = CGC + GGTACC + TCCCGTGTCAATACCAATCA dan SacII + Primer (6495) = CCGCGG + AGCATGATTGTACGCCCTTC. By considering overall sequence of NS-3 DENV-2 genes, epitope, and restriction enzyme on plasmid and NS-3, these primer pair could be use to produce NS-3 DENV-2 recombinant protein as a dengue vaccine candidate."

"ABSTRAKTingginya angka infeksi virus dengue (DENV) di Indonesia merupakan masalahkesehatan yang masih belum tertangani. Pengobatan infeksi DENV hingga saat inimasih mengandalkan imunitas penderita. Berbagai jenis antiviral DENV sedangdikembangkan, salah satunya menggunakan rekayasa genetika berbasis sekuensuntranslated region (UTR). Namun data mengenai UTR DENV masih sedikit. Olehkarena itu, penulis melakukan penelitian untuk menganalisa sekuens danfilogenetik UTR DENV-1. Dalam penelitian ini, dua strain Indonesia dibandingkandengan 25 strain dari GenBank menggunakan program Genetyx 5.1. Hasilpenelitian ini menunjukan bahwa terdapat beberapa sekuens yang lestari, sehinggamemenuhi kriteria sebagai target siRNA, yaitu 3’UAR, CS1, CS2, dan RCS2.Sementara sekuens 5’ UTR tidak memenuhi syarat siRNA karena ditemukanperubahan pada beberapa strain, termasuk strain Indonesia. Filogenetikmenggunakan UTR tidak sesuai dengan filogenetik envelope dan tidak dapatdigunakan untuk menjelaskan pola penyebaran DENV-1.

---

ABSTRACTHigh prevalence of dengue virus (DENV) infection still become an unresolved issuein Indonesia. Treatment for DENV infection relies heavily on natural immunity.Various DENV antivirals are on development, one of them is untranslated region(UTR)-sequence-based. However, there is only a few number of data available onUTR DENV. Therefore, this research was done to analyze the sequence andphylogenetic of UTR DENV-1. Two Indonesia strains were compared with 25strains from GenBank using the Genetyx 5.1 program. There are four conservedsequences that fill criteria as siRNA targets, which are 3’UAR, CS1, CS2, andRCS2. 5’UTR sequence does not fill the siRNA criteria because mutations werefound within some strains, including Indonesia strains. Phylogenetic using UTRdoes not fit envelope phylogenetic and can not be used to explain the DENV-1pattern."

"[ABSTRAKDemam berdarah dengue (DBD) merupakan penyakit yang disebabkan karenainfeksi virus dengue (DENV), yang banyak ditemukan di Indonesia. Belum adaterapi yang spesifik dalam pengobatan DBD. Upaya pengembangan vaksindengue yang efektif sangat diperlukan. Pada penelitian ini dilakukan analisaimunogenisitas kandidat vaksin DNA prM-E dengue serotipe 2 (pUMD2.kl.20)dengan menganalisis sel T CD4, sel T CD8, IFN-γ dan TNF-α. pada sel U937 danPBMC secara in vitro, bertujuan untuk mengetahui respon imun ketika vaksindiinjeksikan ke dalam tubuh manusia. Dasar penelitian ini adalah sel U937ditransfeksi dengan pUMD2.kl.20 menggunakan lipofectamin. Sel U937 akanberperan sebagai APCs yang akan mengekspresikan protein prM-E DENV-2 danmempresentasikan protein tersebut melalui molekul MHC class I dan MHC classII kepada Peripheral Blood Mononuclear Cell (PBMC) manusia. Tahapan kerjayang dilakukan dalam penelitian ini terdiri dari: (a) kultur galur sel U937, (b)transfeksi sel U937 dengan pUMD2.kl.20, (c) transfeksi sel U937 dengan plasmids(pUMVC), (d) infeksi sel U937 dengan DENV-2 strain DS.18/09, (e) pewarnaandan pengamatan hasil pewarnaan menggunakan alat semi flowcytometri (TALI).pUMD2.kl.20 mengaktivasi sel T CD4 dan sel T CD8 untuk berploriferasi. Hasilpenelitian ini menunjukkan bahwa konsentrasi sel T CD8 lebih tinggi darikonsentrasi sel T CD4 dan konsentrasi sel positif yang mensekresikan IFNγ lebihtinggi dari konsentrasi sel positif yang mensekresikan TNFα. Kondisi optimal dariaktivasi sel T CD4 oleh pUMD2.kl.20 adalah 24 jam setelah penambahan PBMCsetelah transfeksi (8,53x10⁴sel/ml), untuk sel T CD8 adalah 24 jam setelahpenambahan PBMC setelah transfeksi (49,4x10⁴ sel/ml). Kondisi optimal dariaktivasi sel+ yang mensekresikan IFNγ oleh pUMD2.kl.20 adalah 24 jam setelahpenambahan PBMC 48 jam setelah transfeksi (9,86x10⁴ sel/ml), dan untuk sel+yang mensekresikan TNFα adalah 2 jam setelah penambahan PBMC 48 jamsetelah transfeksi (2,1x10⁴ sel/ml). Dari penelitian ini dapat disimpulkan bahwapUMD2.kl.20 bersifat imunogenik.

---

ABSTRACTDengue hemorrhagic fever (DHF) is a disease caused by infection with denguevirus (DENV), which is found in Indonesia. There is no specific therapy in thetreatment of DHF. An effort to develop an effective dengue vaccine is needed. Inthis research, analysis of the immunogenicity of the DNA vaccine candidate prMEdengue serotype 2 (pUMD2.kl.20) by analyzing the CD4 T cells, CD8 T cells,IFN-γ and TNF-α in U937 cells and PBMC in vitro, aims to determine theimmune response when the vaccine is injected into the human body. This researchapproach is based on transfection of U937 cells with pUMD2.kl.20 usinglipofectamin. U937 cells acts as APCs which will express the protein prM-EDENV-2 and presenting these proteins through the MHC class I and MHC class IImolecule to the Peripheral Blood Mononuclear Cell (PBMC) of human body.Stages of the work in this study consisted of: (a) culture cell line U937, (b)transfection of U937 cells with pUMD2.kl.20, (c) transfection of U937 cells withplasmid (pUMVC), (d) infection of U937 cells with DENV-2 strains DS.18/09,(e) staining and observation results of staining using a semi-flow cytometri(TALI). pUMD2.kl.20 activate CD4 T cells and CD8 T cells to proliferate. CD8 Tcells concentration higher than the concentration of CD4 T cells and the secretionof INFγ-positive cells concentration higher than the concentration of the secretionof TNFα-positive cells. Optimal condition of CD4 T cells activation bypUMD2.kl.20 is 24 hours after the addition of PBMC after transfection (8,53x10⁴cells/ml), for CD8 T cells was 24 hours after the addition of PBMC aftertransfection (49,4x10⁴ cells/ml). Optimal conditions secretion of IFNγ-positivecells were activated by pUMD2.kl.20 is 24 hours after the addition of PBMC 48hours after transfection (9,86x10⁴ cells/ml), and for the secretion of TNFα-positive cells were activated by pUMD2.kl.20 is 2 hours after the addition ofPBMC 48 hours after transfection (2,1x10⁴ cells/ml). From this study it can beconcluded that the pUMD2.kl.20 immunogenic, Dengue hemorrhagic fever (DHF) is a disease caused by infection with denguevirus (DENV), which is found in Indonesia. There is no specific therapy in thetreatment of DHF. An effort to develop an effective dengue vaccine is needed. Inthis research, analysis of the immunogenicity of the DNA vaccine candidate prMEdengue serotype 2 (pUMD2.kl.20) by analyzing the CD4 T cells, CD8 T cells,IFN-γ and TNF-α in U937 cells and PBMC in vitro, aims to determine theimmune response when the vaccine is injected into the human body. This researchapproach is based on transfection of U937 cells with pUMD2.kl.20 usinglipofectamin. U937 cells acts as APCs which will express the protein prM-EDENV-2 and presenting these proteins through the MHC class I and MHC class IImolecule to the Peripheral Blood Mononuclear Cell (PBMC) of human body.Stages of the work in this study consisted of: (a) culture cell line U937, (b)transfection of U937 cells with pUMD2.kl.20, (c) transfection of U937 cells withplasmid (pUMVC), (d) infection of U937 cells with DENV-2 strains DS.18/09,(e) staining and observation results of staining using a semi-flow cytometri(TALI). pUMD2.kl.20 activate CD4 T cells and CD8 T cells to proliferate. CD8 Tcells concentration higher than the concentration of CD4 T cells and the secretionof INFγ-positive cells concentration higher than the concentration of the secretionof TNFα-positive cells. Optimal condition of CD4 T cells activation bypUMD2.kl.20 is 24 hours after the addition of PBMC after transfection (8,53x10⁴cells/ml), for CD8 T cells was 24 hours after the addition of PBMC aftertransfection (49,4x10⁴ cells/ml). Optimal conditions secretion of IFNγ-positivecells were activated by pUMD2.kl.20 is 24 hours after the addition of PBMC 48hours after transfection (9,86x10⁴ cells/ml), and for the secretion of TNFα-positive cells were activated by pUMD2.kl.20 is 2 hours after the addition ofPBMC 48 hours after transfection (2,1x10⁴ cells/ml). From this study it can beconcluded that the pUMD2.kl.20 immunogenic]"

"ABSTRAKInfeksi yang disebabkan oleh virus dengue telah banyak dilaporkan di negara tropis dan subtropis. Virus dengue terdiri dari 4 serotipe yaitu dengue 1-4. Hingga saat ini belum tersedia vaksin yang berlisensi untuk mencegah terjadinya infeksi dengue. Pada penelitian ini dikonstruksi vaksin DNA yang mengkode gen prM-E dan prM-E-NS1del virus dengue 2 strain Indonesia yang akan dijadikan sebagai kandidat vaksin dengue. Hasil penelitian berhasil mendapatkan 9 plasmid rekombinan pUMDE2 yang membawa gen sisipan prM-E dan telah dikonfirmasi dengan melakukan PCR koloni dan restriksi plasmid. Dari hasil sekuensing plasmid pUMDE2 koloni no. 11 ditemukan 19 mutasi asam amino pada gen prM-E, sepuluh mutasi pada gen prM dan sembilan mutasi pada gen E. Mutasi protein prM N29D dan N52K serta protein E V164I dan S390N terletak pada daerah epitop pengenalan sel B. Transfeksi plasmid pUMDE2 dilakukan pada sel Chinese Hamster Ovary (CHO)-K1 dan menunjukkan adanya ekspresi protein prM-E rekombinan berdasarkan uji imunostaining dan ELISA. Hasil ELISA menunjukkan bahwa protein ditemukan pada sel yang ditransfeksi. Sedangkan, plasmid rekombinan yang membawa gen prM-E-NS1del tidak berhasil dikonstruksi. Plasmid pUMDE2 dapat dikembangkan menjadi kandidat vaksin DNA.

---

ABSTRACT

Infection by dengue virus were reported in tropical and subtropical area. Dengue virus (DENV) consist of 4 serotype, DENV-1 to DENV-4. There is no licensed vaccine available for dengue infection. In this research, we construct DNA vaccine encode prM-E and prM-E-NS1del genes of dengue virus serotype 2 for vaccine development. Nine recombinant plasmids that encode prM-E genes (pUMDE2), were successfully obtained. Recombinant plasmids were confirmed by PCR colony and restriction enzyme analysis. Colony of pUMDE2 no. 11 was sequenced and total 19 amino acid mutations were founds, 10 mutations in prM and 9 mutations in E protein. prM mutations N29D and N52K, E mutations of V164I and S390N were found in B cell epitopes. Transfection pUMDE2 plasmid was done to Chineese Hamster Ovary (CHO)-K1 and showed that recombinant protein prM-E was successfully expressed by immunostaining assay and ELISA. Results showed that the protein was mainly found in cell fraction. However, recombinant plasmid that encode prM-E-NS1del were failed to be constructed. pUMDE2 could be developed for vaccine candidate."

"Demam berdarah merupakan salah satu masalah kesehatan di dunia. Infeksi virus dengue yang berulang dengan serotipe yang berbeda dapat memacu terjadinya demam berdarah bahkan kematian. Dengue serotipe 4 dilaporkan dapat menyebabkan infeksi sekunder yang lebih parah dibandingkan dengue serotipe lainnya. Sampai saat ini pengobatan demam berdarah belum ditemukan, maka itu pencegahan jauh lebih penting. Para peneliti telah merekomendasikan vaksin aman berbasis nonstructural protein 1 (NS1) karena sifat imunogeniknya. Mereka telah mengidentifikasi empat epitope di NS1 yang diduga bereaksi kuat dengan epitope B cells, yaitu LD2, 24A, LX1, 24C. Tujuan dari riset ini adalah untuk menganalisa dan membandingkan strain DENV-4 yang diisolasi di Jakarta 2010 dengan 34 strain DENV-4 lainnya yang didapat dari GenBank menggunakan UGENE software sebagai basis dari pengembangan vaksin. Penelitian ini menggunakan data sekunder berupa urutan nukelotida virus dengue serotipe 4 strain IDSS44/10 yang diamplifikasi dan diurutkan di Departemen Mikrobiologi, FKUI. Dari hasil penelitian ini dapat disimpulkan bahwa gen NS1 dari DENV-4 strain IDSS44/10 dapat digunakan sebagai kandidat vaksin dengue di masa mendatang. Hasil menunjukkan bahwa epitope 24C menunjukkan motif yang homolog di setiap sekuens asam amino pada NS1 DENV-4. Hampir seluruh DENV-4 strain yang diisolasi termasuk IDSS44/2010 memiliki urutan asam amino yang sama pada epitop LD2, 24A, LX1, 24C.

---

Dengue hemorrhagic fever has become a worldwide issue. Heterologous infection by different serotypes may lead to this advanced stage of dengue infection and even death. Dengue virus serotype 4 has been reported to cause more severe secondary infection compared to other serotypes. To date, there is no specific treatment for this disease therefore prevention is much more important.

Researchers have proposed a safe vaccine strategy that is based on nonstructural protein 1 (NS1) as it is strongly immunogenic. They identified four epitopes on NS1 that reacted strongly to B cell epitopes which are LD2, 24A, LX1, and 24C. The goal of this research is to identify and compare these NS1 epitopes among DENV-4isolated in Indonesia 2010 with other DENV-4 strains using UGENE softwareas a base of vaccine development. This study used a nucleotide sequence data of DENV-4 strain IDSS44/10 that was amplified and sequenced in Microbiology Department, FKUI.

The results show that NS1 gene DENV-4, IDSS44/2010 strain could be used as a dengue vaccine candidate in the future.The results show that 24C epitope was highly conserved among 35 DENV-4 NS1 sequences. Most of the DENV-4 including IDSS44/10 Indonesian strain have similar amino acids sequences on the epitopes (LD2, 24A, LX1, and 24C)."

"ABSTRAKPenelitian terkait karakteristik genetik sekuens virus dengue (DENV) diperlukan dalam menilai kekerabatan antara strain DENV yang tersebar di seluruh dunia. Tujuan dalam penelitian ini adalah membandingkan karakteristik genotype dan sekuens data DENV serotipe 2 (DENV-2) nukleotida envelope dibandingkan dengan sekuens data DENV-2 nukleotida Non-Struktural 1 (NS1). Data didapatkan dari Laboratorium Mikrobiologi Fakultas Kedokteran Universitas Indonesia untuk strain data yang berasal dari Indonesia dan GenBank untuk strain data yang berasal dari seluruh dunia sebagai data pembanding dengan jumlah sebanyak 42 data, yang kemudian dianalisis menggunakan Genetyx 5.1. Hasil penelitian didapatkan bahwa sekuens data NS1 strain DENV-2 yang berasal dari Indonesia termasuk ke dalam kelompok genotype Cosmopolitan, serupa dengan hasil analisis data dengan sekuens data envelope strain DENV-2. Sementara pada analisis epitope LX1 yang merupakan epitope khas dari NS1, terdapat berbagai peubahan komponen asam amino pada epitope tersebut dibandingkan dengan sekuens data strain Indonesia yang tergabung ke dalam kelompok genotype Cosmopolitan. Kesimpulan dari penelitian ini adalah bahwa filogenetik dengan menggunakan NS1 sebagai bahan analisis dapat digunakan untuk menentukan genotipe. Sehingga gen NS1 pada DENV-2 strain Indonesia masih dapat dipertimbangkan sebagai salah satu dasar metode pengembangan vaksin.

---

ABSTRACTStudies about genetic characteristic between dengue virus serotype 2 (DENV-2) sequence data is needed to determine its relationship between DENV strain over the world. The main purpose of this study is to compare between characteristic of sequence data DENV-2 envelope nucleotide and sequence data DENV-2 Non- Structural 1 (NS1) nucleotide, and analyze between amino acid homology in this study and related previous studies. 42 data used for this study are obtained from Laboratory of Microbiology Faculty of Medicine University of Indonesia for data from Indonesia and form GenBank for data from other countries as a comparison, which is analyzed with software Genetyx 5.1. NS1 sequence data from DENV-2 strain from Indonesia is classified in Cosmpolitan genotype group, which are similar than data analysis from envelope sequence data from same data. Meanwhile in analysis of LX1 epitope, which is considered as typical epitope from NS1, there are any differences in amino acid component at it compared than strain Indonesia data sequences which are included in Cosmopolitan genotype group. As a conclusion, phylogenetic analysis of NS1 nucleotide is useful for determining the genotypes, which means NS1 DENV-2 gene strain Indonesia can be useful as the basis for vaccine development"

"Demam berdarah dengue (DBD) merupakan penyakit yang disebabkan oleh infeksi virus dengue (DENV) dan masih menjadi endemi di negara-negara tropis dan subtropis. Salah satu bentuk pencegahan infeksi DENV adalah vaksinasi. Salah satu platform vaksin DENV yang dikembangkan adalah vaksin inaktif. Penelitian ini menggunakan empat metode inaktivasi DENV, yaitu formaldehid, psoralen 4′-Aminomethyltrioxsalen hydrochloride (AMT), UV dan pemanasan. Virus yang sudah diinaktivasi diuji antigenisitas, viabilitas, dan imunogenisitas menggunakan ELISA, focus assay, dan mencit Balb/C, secara berurutan. Imunisasi mencit dilakukan dengan menyuntikkan 10μg protein dalam 50μl per mencit. Titer antibodi IgG dan antibodi netralisasi pasca imunisasi dianalisa menggunakan ELISA dan focus reduction neutralization assay (FRNT). Hasil uji imunogenisitas menggunakan ELISA, menunjukkan kenaikan titer antibodi pada mencit yang divaksinasi. Vaksin inaktif dengan formaldehid menginduksi titer antibodi tertinggi. Sedangkan, hasil uji imunogenisitas dengan FRNT, virus yang diinaktivasi dengan formaldehid dan AMT, menghasilkan titer antibodi netralisasi yang lebih tinggi dibandingkan dengan virus yang diinaktivasi dengan metode lainnya. Titer FRNT50 dan FRNT90 pada vaksin yang diinaktivasi dengan formaldehid dan AMT memiliki titer yang sama, yaitu 1/80 dan 1/10. Hasil tersebut menunjukkan bahwa inaktivasi virus dengan formaldehid dan AMT berpotensi untuk dikembangkan menjadi kandidat vaksin DENV di masa mendatang.

---

Dengue hemorrhagic fever (DHF) is a disease caused by dengue virus (DENV) infection and is still endemic in tropical and subtropical countries. One form of prevention of DENV infection is vaccination. One of the DENV vaccine platforms developed is an inactivated vaccine. This study used four DENV inactivation methods, namely formaldehyde, psoralen 4′-Aminomethyltrioxsalen hydrochloride (AMT), UV and heating. The inactivated virus was tested for antigenicity, viability, and immunogenicity using ELISA, focus assay, and Balb/C mice, respectively. Immunization of mice was performed by injecting 10μg of protein in 50μl per mice. IgG antibody titers and neutralization antibodies after immunization were analyzed using ELISA and focus reduction neutralization assay (FRNT). Immunogenicity test results using ELISA showed an increase in antibody titer in vaccinated mice. Formaldehyde inactivation vaccine induced the highest antibody titer. Meanwhile, the results of immunogenicity tests with FRNT, viruses inactivated with formaldehyde and AMT, produced higher neutralization antibody titers compared to viruses inactivated by other methods. The titer of FRNT50 and FRNT90 in vaccines inactivated with formaldehyde and AMT had the same titer, namely 1/80 and 1/10. These results indicate that virus inactivation with formaldehyde and AMT has the potential to be developed into DENV vaccine candidates in the future."